Incidental Mutation 'R5356:Nme8'
ID424119
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene NameNME/NM23 family member 8
SynonymsSptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission 042935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5356 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location19645078-19697794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19652299 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 236 (F236L)
Ref Sequence ENSEMBL: ENSMUSP00000152780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763] [ENSMUST00000223466]
Predicted Effect probably benign
Transcript: ENSMUST00000039340
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091763
AA Change: F475L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: F475L

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221343
Predicted Effect probably damaging
Transcript: ENSMUST00000223466
AA Change: F236L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,065,256 T162I probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Amn1 T C 6: 149,166,894 I205M possibly damaging Het
Ankrd50 A C 3: 38,456,185 S678A probably damaging Het
Atg13 G A 2: 91,692,466 R78* probably null Het
Bmper T G 9: 23,373,861 F235L probably benign Het
Btn2a2 C T 13: 23,482,875 V187I probably benign Het
Cabs1 G A 5: 87,979,633 V48I probably benign Het
Cacnb3 A G 15: 98,641,617 I212V probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cep162 T C 9: 87,206,895 E978G probably damaging Het
Cmya5 A T 13: 93,063,485 L3445Q probably damaging Het
Cntrl T A 2: 35,148,899 L1067* probably null Het
Cyp20a1 G A 1: 60,379,387 V329I probably benign Het
Cyp2d11 A T 15: 82,390,511 N288K probably benign Het
D430041D05Rik T G 2: 104,255,409 T932P probably damaging Het
Dlk1 T A 12: 109,455,521 C54S probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Entpd6 T A 2: 150,770,383 F416L probably damaging Het
Evx1 A G 6: 52,316,617 T257A probably benign Het
Fpr-rs3 A T 17: 20,624,334 S182T probably damaging Het
Glra3 A T 8: 55,940,901 I16F probably benign Het
Gm11437 C A 11: 84,152,687 L259F possibly damaging Het
Gorasp1 A T 9: 119,927,958 L386Q probably damaging Het
Gpsm1 T C 2: 26,340,562 V508A possibly damaging Het
Gstm1 T A 3: 108,012,736 I180F probably benign Het
Hc T C 2: 34,994,995 D1400G probably benign Het
Lrp2 A G 2: 69,464,708 V3422A possibly damaging Het
Map3k4 A G 17: 12,247,308 V1128A possibly damaging Het
Mboat2 G C 12: 24,957,573 V363L probably benign Het
Mgat3 A G 15: 80,211,610 I213V possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mtf2 A T 5: 108,106,610 T426S possibly damaging Het
Muc3a T C 5: 137,210,564 I151V probably benign Het
Myh6 T C 14: 54,953,762 E874G probably damaging Het
Myo15 G A 11: 60,498,366 G2030R probably damaging Het
Ncdn T C 4: 126,747,228 Y493C probably damaging Het
Ncoa6 A G 2: 155,421,192 F441L probably damaging Het
Ndc80 A T 17: 71,521,108 S75T possibly damaging Het
Nf1 T C 11: 79,473,456 F1571L possibly damaging Het
Nsmce4a C A 7: 130,537,048 V289L probably damaging Het
Ntrk2 A T 13: 59,060,242 D634V probably damaging Het
Pcsk6 G C 7: 65,970,592 E479Q probably damaging Het
Pkd1 A G 17: 24,593,577 Q3828R probably damaging Het
Ptov1 T A 7: 44,864,665 T295S probably damaging Het
Ptprf A G 4: 118,226,338 M824T probably benign Het
Rbm6 T A 9: 107,852,666 H129L probably damaging Het
Rbm8a2 A G 1: 175,978,689 I74T possibly damaging Het
Ret A G 6: 118,197,118 S6P possibly damaging Het
Rspo3 A T 10: 29,500,068 C70* probably null Het
Sike1 C A 3: 103,001,790 A202D possibly damaging Het
Slc9a3r2 A G 17: 24,641,971 V88A probably damaging Het
Slco4c1 G T 1: 96,832,110 P499H probably damaging Het
Smg1 A G 7: 118,195,133 probably benign Het
Tmem135 A G 7: 89,305,515 V98A probably benign Het
Tor4a T A 2: 25,195,906 probably null Het
Txlna A G 4: 129,630,373 F397S probably damaging Het
Tyk2 A G 9: 21,115,744 I581T probably benign Het
Unc13a C T 8: 71,662,514 D164N probably benign Het
Vwa3b T C 1: 37,114,583 I502T probably damaging Het
Xrcc6 A G 15: 82,029,218 T6A probably benign Het
Zfp524 T C 7: 5,018,433 V320A probably benign Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CAAGGCATCTTTTCATGAGTCAG -3'
(R):5'- CCTAAAGGTCTTATGGCTGTGAAC -3'

Sequencing Primer
(F):5'- GGCATCTTTTCATGAGTCAGATTAG -3'
(R):5'- TGGCTGTGAACTTTTAATTGTCAC -3'
Posted On2016-08-04