Incidental Mutation 'R5358:St7'
ID424160
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Namesuppression of tumorigenicity 7
SynonymsRAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 042937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5358 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17692933-17943025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17819318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000115215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
Predicted Effect probably damaging
Transcript: ENSMUST00000000674
AA Change: S28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: S28P

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052113
AA Change: S74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053148
AA Change: S31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: S31P

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077080
AA Change: S28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: S28P

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: S74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115417
AA Change: S31P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: S31P

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115418
AA Change: S74P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: S74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115420
AA Change: S74P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127181
AA Change: I80T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144021
AA Change: I80T
Predicted Effect probably damaging
Transcript: ENSMUST00000144488
AA Change: S74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534
AA Change: S74P

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,013,331 V1842A probably damaging Het
Abi3 A T 11: 95,842,108 F13L probably benign Het
Adgre4 A G 17: 55,818,758 K538R probably benign Het
Bcas3 C T 11: 85,451,755 H191Y probably benign Het
Bicdl2 A G 17: 23,667,564 T376A probably benign Het
Ceacam18 C A 7: 43,637,073 N123K possibly damaging Het
Celsr3 C T 9: 108,832,025 R1357C possibly damaging Het
Chek2 T C 5: 110,841,282 probably benign Het
Chmp7 A G 14: 69,721,235 V210A probably benign Het
Chrm2 A G 6: 36,523,355 K49R probably damaging Het
Daam1 T A 12: 71,952,459 L623* probably null Het
Ddx31 T A 2: 28,863,770 C448S probably damaging Het
Dnah7a A G 1: 53,547,172 S1507P probably damaging Het
Dnah8 C A 17: 30,746,954 T2420K probably damaging Het
Dyrk3 C T 1: 131,129,695 R247H probably damaging Het
Exoc4 A G 6: 33,265,999 E49G probably damaging Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fam96b T C 8: 104,641,650 N14S probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxj3 A G 4: 119,619,399 E258G probably damaging Het
Gata4 C T 14: 63,240,626 A175T probably benign Het
Helz2 C T 2: 181,235,528 E1106K probably damaging Het
Hip1 G T 5: 135,436,398 S385R probably benign Het
Igsf9 C T 1: 172,484,511 T8I probably benign Het
Katnal2 A G 18: 77,017,494 Y86H possibly damaging Het
Kcnh6 A T 11: 106,027,591 I756F possibly damaging Het
Kdm5b C T 1: 134,607,694 R570* probably null Het
Kif16b T A 2: 142,740,969 R545S probably damaging Het
Kif21b T A 1: 136,172,292 I1528N possibly damaging Het
Kmt2a T C 9: 44,819,274 probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mknk2 T C 10: 80,671,763 T60A probably benign Het
Ncoa6 T C 2: 155,406,987 K1466E probably damaging Het
Ntsr2 A C 12: 16,654,082 T109P probably damaging Het
Nup214 C A 2: 32,017,146 S995Y unknown Het
Olfr448 A T 6: 42,896,520 Q23L probably benign Het
Pclo T A 5: 14,712,736 L456* probably null Het
Pde5a A G 3: 122,748,176 D105G probably damaging Het
Pik3c3 C A 18: 30,323,544 P709H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3c T C 13: 110,061,963 N179S possibly damaging Het
Setdb2 T A 14: 59,409,436 R559S probably benign Het
Sf3b1 A G 1: 55,003,310 Y474H probably benign Het
Slc6a6 G T 6: 91,735,174 W228L probably benign Het
Slc8a2 T G 7: 16,157,303 I750S probably damaging Het
Slco2b1 T A 7: 99,660,044 I194L unknown Het
Smarcd1 C T 15: 99,703,247 Q45* probably null Het
Srcap T G 7: 127,540,320 L1271R probably damaging Het
Srsf12 A T 4: 33,209,330 N9Y probably damaging Het
Stxbp5l T A 16: 37,174,326 E739V probably damaging Het
Sun3 T A 11: 9,031,496 Q36L possibly damaging Het
Tbc1d32 T C 10: 56,170,937 H545R possibly damaging Het
Tcp11 A T 17: 28,078,020 C133S probably benign Het
Tm6sf2 T C 8: 70,074,289 V36A possibly damaging Het
Tmem108 T C 9: 103,499,518 Y244C probably damaging Het
Tra2a A T 6: 49,251,015 probably benign Het
Trpm3 A T 19: 22,925,968 I1031F probably damaging Het
Ttll3 A G 6: 113,401,331 K381E probably benign Het
Uaca T C 9: 60,871,148 V937A probably benign Het
Umod C T 7: 119,472,354 G388D probably damaging Het
Vmn2r90 G A 17: 17,704,150 probably null Het
Zfp644 G A 5: 106,635,675 T1002I probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Zfp738 A G 13: 67,671,012 Y287H probably damaging Het
Zfyve16 T C 13: 92,508,263 T1144A probably benign Het
Zgrf1 T C 3: 127,567,703 probably null Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
IGL02980:St7 UTSW 6 17749546 intron probably benign
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2039:St7 UTSW 6 17886112 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2874:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3076:St7 UTSW 6 17846238 nonsense probably null
R3921:St7 UTSW 6 17846245 missense probably benign 0.31
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 unclassified probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATCAGGAATGAATGATTTCAC -3'
(R):5'- ACCTGGGTAAGTTCACCTCTTC -3'

Sequencing Primer
(F):5'- GCAGGGGTTCAGTTTCTAAAACC -3'
(R):5'- CTCTTTATCCCCATCCAACATGAAG -3'
Posted On2016-08-04