Incidental Mutation 'R5360:Trp53'
ID 424300
Institutional Source Beutler Lab
Gene Symbol Trp53
Ensembl Gene ENSMUSG00000059552
Gene Name transformation related protein 53
Synonyms p53, p44
MMRRC Submission 042939-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5360 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69471185-69482699 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 69479566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
AlphaFold P02340
Predicted Effect probably null
Transcript: ENSMUST00000005371
SMART Domains Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 1.3e-10 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 8.2e-108 PFAM
Pfam:P53_tetramer 312 353 4.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108657
SMART Domains Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 6.1e-11 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 4.7e-108 PFAM
Pfam:P53_tetramer 312 353 1.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108658
SMART Domains Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.4e-12 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 9.8e-113 PFAM
Pfam:P53_tetramer 316 355 5.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147512
Predicted Effect probably null
Transcript: ENSMUST00000171247
SMART Domains Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.2e-10 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 7.9e-108 PFAM
Pfam:P53_tetramer 315 356 4.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T A 19: 55,279,592 (GRCm39) Y443* probably null Het
Aox3 C T 1: 58,185,667 (GRCm39) T331M probably damaging Het
Arhgap32 G A 9: 32,170,967 (GRCm39) R1598H probably damaging Het
Atp1a2 A G 1: 172,106,436 (GRCm39) probably null Het
Brpf3 A T 17: 29,029,536 (GRCm39) M499L probably benign Het
Cacnb1 A T 11: 97,909,097 (GRCm39) probably null Het
Cep295 A G 9: 15,238,029 (GRCm39) S1899P probably damaging Het
Cntn2 A G 1: 132,446,595 (GRCm39) Y748H probably damaging Het
Csmd3 T A 15: 47,532,599 (GRCm39) Y2532F probably damaging Het
Cstdc1 G T 2: 148,625,298 (GRCm39) L77F probably damaging Het
Dsg1a A G 18: 20,474,011 (GRCm39) D1028G probably damaging Het
Eif1ad16 A C 12: 87,985,265 (GRCm39) L93V probably benign Het
Elp1 A T 4: 56,800,104 (GRCm39) H7Q probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Gabra5 C T 7: 57,140,533 (GRCm39) G55R probably damaging Het
Gdf9 T A 11: 53,328,034 (GRCm39) F330Y probably benign Het
Gimap8 T C 6: 48,633,236 (GRCm39) S352P probably damaging Het
Gm4952 A T 19: 12,600,993 (GRCm39) H71L probably benign Het
Gnaq G A 19: 16,110,790 (GRCm39) R34H probably benign Het
Hebp2 T C 10: 18,420,055 (GRCm39) D126G probably benign Het
Hectd4 A G 5: 121,453,464 (GRCm39) D601G possibly damaging Het
Hook2 T C 8: 85,728,033 (GRCm39) Y577H probably damaging Het
Igfals A G 17: 25,099,067 (GRCm39) T53A probably benign Het
Igsf9b A G 9: 27,222,968 (GRCm39) D123G probably damaging Het
Ilrun A T 17: 28,013,020 (GRCm39) I59N probably damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mdm4 A T 1: 132,919,396 (GRCm39) *490K probably null Het
Melk C T 4: 44,363,730 (GRCm39) T592M probably damaging Het
Neurl2 C A 2: 164,675,021 (GRCm39) A114S probably damaging Het
Nuggc A G 14: 65,876,075 (GRCm39) T563A probably damaging Het
Or8g32 T G 9: 39,305,698 (GRCm39) F204V probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pdlim1 A T 19: 40,218,993 (GRCm39) S213T probably damaging Het
Pitx1 T C 13: 55,976,291 (GRCm39) I123V probably damaging Het
Pkd1l1 T C 11: 8,829,204 (GRCm39) N1013D probably benign Het
Pla2g2c T A 4: 138,461,656 (GRCm39) Y42N possibly damaging Het
Polr2b G A 5: 77,496,993 (GRCm39) A1168T possibly damaging Het
Ppp2r2a G A 14: 67,254,020 (GRCm39) R383* probably null Het
Prl7a2 C T 13: 27,843,143 (GRCm39) R220H probably benign Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rc3h2 A G 2: 37,279,867 (GRCm39) V454A possibly damaging Het
Robo1 A G 16: 72,732,665 (GRCm39) T307A probably damaging Het
Slc22a6 T C 19: 8,596,786 (GRCm39) L188P probably damaging Het
Spag17 A G 3: 100,016,726 (GRCm39) N2167S probably benign Het
Spag5 G A 11: 78,205,588 (GRCm39) E680K probably damaging Het
Spata6 A G 4: 111,680,026 (GRCm39) Y428C possibly damaging Het
Tbc1d5 T C 17: 51,291,660 (GRCm39) D47G probably benign Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,654,707 (GRCm39) probably benign Het
Ttc39b T C 4: 83,180,084 (GRCm39) D103G probably damaging Het
Ttn A C 2: 76,750,322 (GRCm39) W3576G probably benign Het
Yeats2 T A 16: 19,972,912 (GRCm39) M22K probably damaging Het
Other mutations in Trp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Trp53 APN 11 69,479,349 (GRCm39) missense probably damaging 1.00
IGL02105:Trp53 APN 11 69,479,329 (GRCm39) missense probably damaging 1.00
R0112:Trp53 UTSW 11 69,479,505 (GRCm39) missense probably damaging 1.00
R0196:Trp53 UTSW 11 69,479,506 (GRCm39) missense probably damaging 1.00
R0512:Trp53 UTSW 11 69,479,509 (GRCm39) missense probably damaging 1.00
R1976:Trp53 UTSW 11 69,479,323 (GRCm39) missense probably damaging 1.00
R2070:Trp53 UTSW 11 69,480,458 (GRCm39) missense probably damaging 1.00
R2071:Trp53 UTSW 11 69,480,458 (GRCm39) missense probably damaging 1.00
R2988:Trp53 UTSW 11 69,479,332 (GRCm39) missense probably damaging 1.00
R4698:Trp53 UTSW 11 69,479,248 (GRCm39) nonsense probably null
R4776:Trp53 UTSW 11 69,477,747 (GRCm39) missense probably benign 0.05
R4838:Trp53 UTSW 11 69,478,456 (GRCm39) missense probably damaging 1.00
R5269:Trp53 UTSW 11 69,480,031 (GRCm39) missense probably damaging 1.00
R5399:Trp53 UTSW 11 69,479,372 (GRCm39) missense probably benign 0.19
R5420:Trp53 UTSW 11 69,479,146 (GRCm39) intron probably benign
R5982:Trp53 UTSW 11 69,478,244 (GRCm39) missense probably benign 0.06
R6051:Trp53 UTSW 11 69,480,434 (GRCm39) missense possibly damaging 0.93
R6305:Trp53 UTSW 11 69,479,533 (GRCm39) missense probably damaging 1.00
R6457:Trp53 UTSW 11 69,480,440 (GRCm39) missense probably damaging 1.00
R6947:Trp53 UTSW 11 69,479,307 (GRCm39) missense possibly damaging 0.93
R7278:Trp53 UTSW 11 69,482,081 (GRCm39) missense probably benign 0.00
R7339:Trp53 UTSW 11 69,480,015 (GRCm39) missense probably damaging 1.00
R7418:Trp53 UTSW 11 69,479,214 (GRCm39) missense probably damaging 1.00
R7899:Trp53 UTSW 11 69,481,519 (GRCm39) missense probably damaging 1.00
R8344:Trp53 UTSW 11 69,478,409 (GRCm39) missense probably damaging 1.00
R8796:Trp53 UTSW 11 69,480,434 (GRCm39) missense possibly damaging 0.93
R9197:Trp53 UTSW 11 69,480,000 (GRCm39) missense probably damaging 1.00
R9375:Trp53 UTSW 11 69,480,537 (GRCm39) critical splice donor site probably null
R9390:Trp53 UTSW 11 69,478,394 (GRCm39) missense probably benign 0.23
R9568:Trp53 UTSW 11 69,478,392 (GRCm39) nonsense probably null
Z1176:Trp53 UTSW 11 69,480,076 (GRCm39) missense probably null 0.94
Z1176:Trp53 UTSW 11 69,480,028 (GRCm39) missense probably damaging 1.00
Z1177:Trp53 UTSW 11 69,480,037 (GRCm39) missense probably damaging 0.99
Z1177:Trp53 UTSW 11 69,479,188 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCCGATGGTGATGGTAAGC -3'
(R):5'- TCTATTTCCCGCCTGGATGG -3'

Sequencing Primer
(F):5'- TGGTGATGGTAAGCCCTCAACAC -3'
(R):5'- GCCTGGATGGGGAAGCC -3'
Posted On 2016-08-04