Mutagenetix > Incidental Mutation

Incidental Mutation 'R5286:Gprc5b'

424357

Institutional Source

Beutler Lab

Gene Symbol

Gprc5b

Ensembl Gene

ENSMUSG00000008734

Gene Name

G protein-coupled receptor, family C, group 5, member B

Synonyms

hypothetical protein, clone 2-63

MMRRC Submission

042870-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R5286 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118571270-118594434 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118582910 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 320 (F320I)

Ref Sequence

ENSEMBL: ENSMUSP00000146777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]

AlphaFold

Q923Z0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008878
AA Change: F320I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: F320I

Domain	Start	End	E-Value	Type
Pfam:7tm_3	67	294	2e-33	PFAM
low complexity region	360	371	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208394
AA Change: F320I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.0952

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	T	C	5: 121,742,358 (GRCm39)	I417V	probably benign	Het
Adad1	T	C	3: 37,119,399 (GRCm39)	V160A	possibly damaging	Het
Adcy7	A	G	8: 89,051,487 (GRCm39)	E869G	probably damaging	Het
Birc6	G	A	17: 74,977,242 (GRCm39)	A4352T	probably damaging	Het
Brd2	T	A	17: 34,334,205 (GRCm39)	T286S	probably damaging	Het
Bsn	G	T	9: 107,988,123 (GRCm39)		probably benign	Het
Cables1	A	G	18: 12,057,884 (GRCm39)	T335A	probably benign	Het
Cacna1d	A	T	14: 30,072,682 (GRCm39)	S98T	possibly damaging	Het
Ccdc181	A	G	1: 164,105,810 (GRCm39)	Y15C	probably damaging	Het
Dlgap4	T	G	2: 156,587,839 (GRCm39)	V39G	probably damaging	Het
Epb41l3	G	A	17: 69,569,268 (GRCm39)	R504H	probably benign	Het
Fbxo7	T	C	10: 85,857,954 (GRCm39)	L23P	probably damaging	Het
Gm42791	A	C	5: 148,887,178 (GRCm39)		probably benign	Het
Gtf3c1	G	A	7: 125,262,580 (GRCm39)	T1093M	possibly damaging	Het
Hddc3	G	T	7: 79,993,543 (GRCm39)	R83L	probably damaging	Het
Iars2	T	C	1: 185,055,318 (GRCm39)		probably benign	Het
Ift25	T	A	4: 107,136,998 (GRCm39)	I132N	probably damaging	Het
Igfn1	T	C	1: 135,895,599 (GRCm39)	K1656E	probably benign	Het
Itk	A	C	11: 46,228,926 (GRCm39)		probably null	Het
Klra6	G	A	6: 129,995,932 (GRCm39)	T142I	probably benign	Het
Knop1	C	T	7: 118,454,993 (GRCm39)	A3T	probably damaging	Het
Lamc3	A	G	2: 31,808,608 (GRCm39)	H788R	probably damaging	Het
Lrif1	A	G	3: 106,639,859 (GRCm39)	R315G	probably damaging	Het
Mfap3l	A	G	8: 61,109,903 (GRCm39)	D93G	probably benign	Het
Ngef	T	C	1: 87,473,552 (GRCm39)	S77G	probably benign	Het
Nt5dc3	T	C	10: 86,640,656 (GRCm39)	S13P	probably benign	Het
Or9s13	T	C	1: 92,548,084 (GRCm39)	V152A	probably benign	Het
Pclo	T	C	5: 14,729,761 (GRCm39)		probably benign	Het
Pkhd1l1	C	T	15: 44,378,368 (GRCm39)	Q1041*	probably null	Het
Ppl	G	A	16: 4,906,987 (GRCm39)	R1103*	probably null	Het
Ppp4r3b	T	A	11: 29,161,667 (GRCm39)	D680E	probably benign	Het
Rasgrf2	T	G	13: 92,267,941 (GRCm39)	K21T	possibly damaging	Het
Rev1	T	A	1: 38,094,407 (GRCm39)	K1004*	probably null	Het
Rgs9	T	G	11: 109,130,277 (GRCm39)		probably null	Het
Rnf31	T	C	14: 55,829,693 (GRCm39)	L86P	probably damaging	Het
Rps13	A	G	7: 115,933,155 (GRCm39)	Y18H	probably damaging	Het
Rxfp2	T	C	5: 149,958,909 (GRCm39)	F33S	probably damaging	Het
Sfmbt1	G	A	14: 30,538,777 (GRCm39)	V799M	probably damaging	Het
Stard9	T	A	2: 120,532,428 (GRCm39)	V2895D	probably benign	Het
Syn3	T	C	10: 86,187,428 (GRCm39)	N232S	possibly damaging	Het
Taok3	T	A	5: 117,404,140 (GRCm39)	Y772N	probably damaging	Het
Tspan4	A	G	7: 141,062,483 (GRCm39)		probably null	Het
Ttn	C	A	2: 76,684,530 (GRCm39)		probably benign	Het
Vwa3b	T	A	1: 37,084,120 (GRCm39)	W98R	probably damaging	Het
Vwa5b2	A	T	16: 20,415,058 (GRCm39)	D360V	probably damaging	Het
Wdr73	A	T	7: 80,541,557 (GRCm39)	D328E	probably benign	Het
Xpo5	A	G	17: 46,545,406 (GRCm39)	N824S	probably benign	Het
Zbtb2	C	T	10: 4,318,566 (GRCm39)	G487S	possibly damaging	Het

Other mutations in Gprc5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Gprc5b	APN	7	118,583,084 (GRCm39)	missense	probably benign
IGL01687:Gprc5b	APN	7	118,583,209 (GRCm39)	missense	possibly damaging	0.67
IGL02937:Gprc5b	APN	7	118,583,017 (GRCm39)	missense	probably benign	0.36
IGL03088:Gprc5b	APN	7	118,582,856 (GRCm39)	missense	probably benign	0.08
IGL03106:Gprc5b	APN	7	118,583,416 (GRCm39)	missense	probably damaging	1.00
IGL03166:Gprc5b	APN	7	118,583,222 (GRCm39)	missense	probably benign	0.20
R0189:Gprc5b	UTSW	7	118,582,856 (GRCm39)	missense	probably benign	0.08
R0588:Gprc5b	UTSW	7	118,583,218 (GRCm39)	missense	probably benign
R1563:Gprc5b	UTSW	7	118,582,984 (GRCm39)	missense	probably benign	0.22
R2126:Gprc5b	UTSW	7	118,583,398 (GRCm39)	missense	probably damaging	1.00
R2842:Gprc5b	UTSW	7	118,583,302 (GRCm39)	missense	possibly damaging	0.93
R3153:Gprc5b	UTSW	7	118,575,770 (GRCm39)	missense	probably damaging	1.00
R3802:Gprc5b	UTSW	7	118,582,943 (GRCm39)	missense	possibly damaging	0.92
R3978:Gprc5b	UTSW	7	118,583,354 (GRCm39)	missense	probably damaging	1.00
R4007:Gprc5b	UTSW	7	118,583,437 (GRCm39)	missense	possibly damaging	0.55
R4183:Gprc5b	UTSW	7	118,583,749 (GRCm39)	missense	probably benign	0.03
R4297:Gprc5b	UTSW	7	118,583,437 (GRCm39)	missense	possibly damaging	0.55
R4298:Gprc5b	UTSW	7	118,583,437 (GRCm39)	missense	possibly damaging	0.55
R4299:Gprc5b	UTSW	7	118,583,437 (GRCm39)	missense	possibly damaging	0.55
R6492:Gprc5b	UTSW	7	118,583,800 (GRCm39)	missense	possibly damaging	0.68
R6606:Gprc5b	UTSW	7	118,583,296 (GRCm39)	missense	probably benign	0.00
R7085:Gprc5b	UTSW	7	118,582,855 (GRCm39)	missense	probably damaging	0.97
R7312:Gprc5b	UTSW	7	118,583,482 (GRCm39)	missense	probably damaging	1.00
R7593:Gprc5b	UTSW	7	118,583,492 (GRCm39)	missense	probably damaging	1.00
R9180:Gprc5b	UTSW	7	118,583,542 (GRCm39)	missense	probably damaging	1.00
R9383:Gprc5b	UTSW	7	118,575,761 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCTCTGAGCCAGCGTTAGC -3'
(R):5'- CTGGATGACCATGTACCTCTTC -3'

Sequencing Primer
(F):5'- TTAGCAGGGGAGCCATTCG -3'
(R):5'- TCGGCAACTCATTAATTAAGCAGGG -3'

Posted On

2016-08-04