Incidental Mutation 'R5287:Asb18'
ID424386
Institutional Source Beutler Lab
Gene Symbol Asb18
Ensembl Gene ENSMUSG00000067081
Gene Nameankyrin repeat and SOCS box-containing 18
Synonyms
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location89950220-90014666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90014388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000117836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086882] [ENSMUST00000097656] [ENSMUST00000151330] [ENSMUST00000154228]
Predicted Effect probably benign
Transcript: ENSMUST00000086882
AA Change: T64A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084095
Gene: ENSMUSG00000067081
AA Change: T64A

DomainStartEndE-ValueType
Blast:ANK 15 44 3e-8 BLAST
ANK 119 148 5.32e-5 SMART
ANK 151 180 1.99e-4 SMART
ANK 184 213 3.26e2 SMART
ANK 218 247 3.95e1 SMART
ANK 251 289 1.96e3 SMART
ANK 293 322 6.61e-1 SMART
Blast:ANK 329 365 1e-12 BLAST
SOCS_box 422 461 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097656
AA Change: T64A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000095261
Gene: ENSMUSG00000067081
AA Change: T64A

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-8 BLAST
SOCS_box 158 197 4.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151330
AA Change: T64A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117836
Gene: ENSMUSG00000067081
AA Change: T64A

DomainStartEndE-ValueType
Blast:ANK 15 44 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154228
AA Change: T64A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117767
Gene: ENSMUSG00000067081
AA Change: T64A

DomainStartEndE-ValueType
Blast:ANK 15 44 9e-9 BLAST
ANK 78 107 5.32e-5 SMART
ANK 110 139 1.99e-4 SMART
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Asb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Asb18 APN 1 89996241 missense probably benign 0.02
IGL01559:Asb18 APN 1 89954450 missense probably damaging 1.00
IGL02188:Asb18 APN 1 89996299 missense probably benign 0.08
IGL02378:Asb18 APN 1 89992988 missense probably damaging 1.00
IGL02543:Asb18 APN 1 90014391 missense probably damaging 0.99
IGL02828:Asb18 APN 1 89996210 critical splice donor site probably null
IGL02877:Asb18 APN 1 89952811 missense possibly damaging 0.65
IGL03290:Asb18 APN 1 90014574 missense probably damaging 1.00
R0560:Asb18 UTSW 1 90014528 missense probably damaging 1.00
R0671:Asb18 UTSW 1 89993171 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1468:Asb18 UTSW 1 89996283 missense probably damaging 1.00
R1510:Asb18 UTSW 1 89996254 missense possibly damaging 0.62
R1721:Asb18 UTSW 1 89968580 missense probably benign 0.36
R1793:Asb18 UTSW 1 90014555 missense probably damaging 1.00
R1863:Asb18 UTSW 1 90014382 missense probably benign 0.10
R2171:Asb18 UTSW 1 89968697 missense probably benign 0.01
R2348:Asb18 UTSW 1 90014534 missense probably damaging 0.99
R3052:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3053:Asb18 UTSW 1 89992985 missense probably damaging 1.00
R3427:Asb18 UTSW 1 89968593 missense probably damaging 0.99
R4094:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4105:Asb18 UTSW 1 89968521 missense possibly damaging 0.61
R4405:Asb18 UTSW 1 89968689 missense probably benign 0.00
R4815:Asb18 UTSW 1 90014425 missense probably damaging 1.00
R4992:Asb18 UTSW 1 89952863 missense probably benign 0.03
R5403:Asb18 UTSW 1 90014388 missense probably benign 0.01
R5494:Asb18 UTSW 1 89954399 missense probably damaging 1.00
R5504:Asb18 UTSW 1 89993024 missense probably damaging 1.00
R5617:Asb18 UTSW 1 89954462 missense possibly damaging 0.90
R5826:Asb18 UTSW 1 90014538 missense probably damaging 0.97
R6369:Asb18 UTSW 1 90014471 missense probably damaging 0.99
R7474:Asb18 UTSW 1 89993033 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTGTCTACCTGCCAACACAG -3'
(R):5'- GGAGAGATACCACAATGTCCAGC -3'

Sequencing Primer
(F):5'- AACACAGCTGCCGTCTTG -3'
(R):5'- TCCAGCTGGGACTCGCC -3'
Posted On2016-08-04