Incidental Mutation 'R5287:Olfr1416'
ID424388
Institutional Source Beutler Lab
Gene Symbol Olfr1416
Ensembl Gene ENSMUSG00000067064
Gene Nameolfactory receptor 1416
SynonymsMOR103-3, GA_x6K02T2R7CC-81277975-81278913
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92475925-92485113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92480297 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 108 (V108E)
Ref Sequence ENSEMBL: ENSMUSP00000149576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086837] [ENSMUST00000214928]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086837
AA Change: V108E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084048
Gene: ENSMUSG00000067064
AA Change: V108E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-53 PFAM
Pfam:7tm_1 41 290 6.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203760
AA Change: V108E
SMART Domains Protein: ENSMUSP00000145466
Gene: ENSMUSG00000067064
AA Change: V108E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.9e-53 PFAM
Pfam:7tm_1 41 290 6.7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214928
AA Change: V108E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Olfr1416
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1416 APN 1 92480024 missense probably damaging 0.99
IGL00980:Olfr1416 APN 1 92479680 unclassified probably null
IGL01540:Olfr1416 APN 1 92480480 missense probably damaging 0.96
R1146:Olfr1416 UTSW 1 92479890 missense probably damaging 1.00
R1146:Olfr1416 UTSW 1 92479890 missense probably damaging 1.00
R4751:Olfr1416 UTSW 1 92479983 missense probably benign 0.01
R5207:Olfr1416 UTSW 1 92479872 missense probably benign
R5403:Olfr1416 UTSW 1 92480297 missense possibly damaging 0.88
R6074:Olfr1416 UTSW 1 92479775 missense probably benign 0.45
R6232:Olfr1416 UTSW 1 92480583 missense probably benign 0.00
R6355:Olfr1416 UTSW 1 92479980 missense probably benign 0.21
R6378:Olfr1416 UTSW 1 92480456 missense probably damaging 1.00
R6901:Olfr1416 UTSW 1 92480605 missense probably damaging 1.00
X0065:Olfr1416 UTSW 1 92479762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGACATTGGAGCCACAG -3'
(R):5'- GTGGAGAACCTGACCATCATC -3'

Sequencing Primer
(F):5'- CACAGAAGGTGGCGCTG -3'
(R):5'- ATCCTCACTGTCTGGAGCAG -3'
Posted On2016-08-04