Incidental Mutation 'R5287:Spdye4c'
ID424392
Institutional Source Beutler Lab
Gene Symbol Spdye4c
Ensembl Gene ENSMUSG00000074812
Gene Namespeedy/RINGO cell cycle regulator family, member E4C
SynonymsGm355, LOC241634
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128591209-128598464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128592640 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000117916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144559] [ENSMUST00000155430] [ENSMUST00000178601]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120483
Predicted Effect probably benign
Transcript: ENSMUST00000144559
AA Change: S46P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140478
Gene: ENSMUSG00000074812
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Pfam:Spy1 204 335 1.1e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155430
AA Change: S46P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117916
Gene: ENSMUSG00000074812
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178601
AA Change: S46P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135991
Gene: ENSMUSG00000074812
AA Change: S46P

DomainStartEndE-ValueType
Pfam:Spy1 37 168 1.3e-54 PFAM
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Spdye4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Spdye4c APN 2 128592666 missense possibly damaging 0.89
R0616:Spdye4c UTSW 2 128594212 missense possibly damaging 0.94
R1072:Spdye4c UTSW 2 128596637 missense probably benign 0.02
R1455:Spdye4c UTSW 2 128596558 missense probably damaging 1.00
R1545:Spdye4c UTSW 2 128595712 missense probably benign 0.03
R1682:Spdye4c UTSW 2 128592622 missense probably damaging 0.96
R4668:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R4669:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R5445:Spdye4c UTSW 2 128596564 nonsense probably null
R5613:Spdye4c UTSW 2 128592969 missense possibly damaging 0.72
R5629:Spdye4c UTSW 2 128596785 missense probably damaging 1.00
R5786:Spdye4c UTSW 2 128596841 makesense probably null
R5911:Spdye4c UTSW 2 128596074 nonsense probably null
R5912:Spdye4c UTSW 2 128596074 nonsense probably null
R6008:Spdye4c UTSW 2 128596633 missense probably benign 0.00
R6817:Spdye4c UTSW 2 128596510 missense probably damaging 1.00
R6856:Spdye4c UTSW 2 128596130 splice site probably null
R7402:Spdye4c UTSW 2 128592341 start codon destroyed probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCCTGTGAAAGCAACGATAG -3'
(R):5'- CCTTCTCAAGCCTAGTGAGG -3'

Sequencing Primer
(F):5'- TGTGTCACCCTTGGCGC -3'
(R):5'- GTGAGGAATTTACATGTAACACCTG -3'
Posted On2016-08-04