Incidental Mutation 'R5287:Hand2'
ID424409
Institutional Source Beutler Lab
Gene Symbol Hand2
Ensembl Gene ENSMUSG00000038193
Gene Nameheart and neural crest derivatives expressed 2
SynonymsEhand2, bHLHa26, Thing2, Hed, dHAND
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5287 (G1)
Quality Score197
Status Validated
Chromosome8
Chromosomal Location57320983-57324633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57322045 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 47 (L47F)
Ref Sequence ENSEMBL: ENSMUSP00000044983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040104]
Predicted Effect probably damaging
Transcript: ENSMUST00000040104
AA Change: L47F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044983
Gene: ENSMUSG00000038193
AA Change: L47F

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 21 32 N/A INTRINSIC
low complexity region 81 102 N/A INTRINSIC
HLH 105 157 3.91e-17 SMART
low complexity region 172 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226075
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants have defects of the neural crest component of branchial and aortic arches and die from heart failure at embryonic day 10.5. Targeted branchial arch specific enhancer mutants show craniofacial defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Hand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3874:Hand2 UTSW 8 57321976 missense probably benign 0.00
R6534:Hand2 UTSW 8 57322036 missense probably benign 0.19
R7552:Hand2 UTSW 8 57322237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCGGAGTCAGGAGTCC -3'
(R):5'- GTTGATGCTCTGAGTCCTGC -3'

Sequencing Primer
(F):5'- TCTGCCTGGTCGCTGCAG -3'
(R):5'- TCTGAGTCCTGCGCCGC -3'
Posted On2016-08-04