Incidental Mutation 'R5287:Mmp8'
ID424412
Institutional Source Beutler Lab
Gene Symbol Mmp8
Ensembl Gene ENSMUSG00000005800
Gene Namematrix metallopeptidase 8
SynonymsCollagenase-2
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7558456-7568485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7567506 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 456 (A456S)
Ref Sequence ENSEMBL: ENSMUSP00000018765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018765] [ENSMUST00000120900] [ENSMUST00000151853]
Predicted Effect probably benign
Transcript: ENSMUST00000018765
AA Change: A456S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018765
Gene: ENSMUSG00000005800
AA Change: A456S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PG_binding_1 28 86 2e-13 PFAM
ZnMc 104 263 4.38e-60 SMART
HX 285 327 7.51e-10 SMART
HX 329 372 2.16e-10 SMART
HX 377 422 5.91e-17 SMART
HX 424 464 2.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120900
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151853
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152878
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades types I, II and III collagens. Mice lacking the encoded protein exhibit abnormalities in the inflammatory responses to various agents. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null males, and to a lesser extent ovariectomized or tamoxifen-treated null females, show increased susceptibility to chemically-induced skin tumors, a sustained inflammatory response to carcinogens, and increased PMN burden in the alveolar space during LPS-mediated acute lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Mmp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Mmp8 APN 9 7567440 missense probably benign 0.32
IGL02524:Mmp8 APN 9 7560505 missense probably damaging 0.97
IGL03013:Mmp8 APN 9 7561689 missense probably benign 0.00
IGL03032:Mmp8 APN 9 7558529 utr 5 prime probably benign
R0310:Mmp8 UTSW 9 7561454 missense probably benign 0.02
R1444:Mmp8 UTSW 9 7567263 missense probably benign 0.02
R1511:Mmp8 UTSW 9 7566278 missense probably damaging 0.98
R2010:Mmp8 UTSW 9 7567534 nonsense probably null
R4705:Mmp8 UTSW 9 7565549 missense probably benign 0.06
R5521:Mmp8 UTSW 9 7560643 missense probably benign 0.16
R5589:Mmp8 UTSW 9 7566274 missense probably damaging 1.00
R5927:Mmp8 UTSW 9 7563202 missense possibly damaging 0.94
R7123:Mmp8 UTSW 9 7563195 missense probably damaging 1.00
R7298:Mmp8 UTSW 9 7560448 missense probably damaging 1.00
R7489:Mmp8 UTSW 9 7561387 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCCTGCAGGACTGTAAGTGG -3'
(R):5'- AAACGCTGGTTCTTCGAAGAG -3'

Sequencing Primer
(F):5'- TGGGGGAAGTTAACAGCACTG -3'
(R):5'- GGGCTGCAGAGTTAGTTACCAC -3'
Posted On2016-08-04