Incidental Mutation 'R5287:Btnl9'
ID424420
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49169607 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 438 (V438A)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
AA Change: V353A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283
AA Change: V353A

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066531
AA Change: V438A

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: V438A

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131363
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2229:Btnl9 UTSW 11 49169118 missense probably damaging 1.00
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R2386:Btnl9 UTSW 11 49178775 missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5433:Btnl9 UTSW 11 49176003 intron probably benign
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49178885 missense probably benign 0.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAAGACAGCTTCCCGGC -3'
(R):5'- AGTTTTCCGAGGAACAGAGG -3'

Sequencing Primer
(F):5'- AAGTACTCGCAGCGGTTC -3'
(R):5'- TTTTCCGAGGAACAGAGGAGAGG -3'
Posted On2016-08-04