Incidental Mutation 'R5287:Tk1'
ID424422
Institutional Source Beutler Lab
Gene Symbol Tk1
Ensembl Gene ENSMUSG00000025574
Gene Namethymidine kinase 1
SynonymsD530002A18Rik, Tk-1
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score124
Status Validated
Chromosome11
Chromosomal Location117815526-117826092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117816541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 140 (V140E)
Ref Sequence ENSEMBL: ENSMUSP00000026661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026649] [ENSMUST00000026661] [ENSMUST00000120928] [ENSMUST00000132298] [ENSMUST00000143852] [ENSMUST00000177131] [ENSMUST00000177241]
Predicted Effect probably benign
Transcript: ENSMUST00000026649
SMART Domains Protein: ENSMUSP00000026649
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 165 1.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026661
AA Change: V140E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026661
Gene: ENSMUSG00000025574
AA Change: V140E

DomainStartEndE-ValueType
Pfam:TK 19 189 9.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120928
SMART Domains Protein: ENSMUSP00000113941
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 21 135 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141939
Predicted Effect probably benign
Transcript: ENSMUST00000143852
SMART Domains Protein: ENSMUSP00000135529
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
Pfam:MARVEL 14 118 8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153872
Predicted Effect probably benign
Transcript: ENSMUST00000175737
SMART Domains Protein: ENSMUSP00000134879
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:MARVEL 18 121 1.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176936
Predicted Effect probably benign
Transcript: ENSMUST00000177131
SMART Domains Protein: ENSMUSP00000134789
Gene: ENSMUSG00000048277

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:MARVEL 20 162 3.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177241
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic enzyme that catalyzes the addition of a gamma-phosphate group to thymidine. This creates dTMP and is the first step in the biosynthesis of dTTP, which is one component required for DNA replication. The encoded protein, whose levels fluctuate depending on the cell cycle stage, can act as a low activity dimer or a high activity tetramer. High levels of this protein have been used as a biomarker for diagnosing and categorizing many types of cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Nullizygous mice show partial postnatal lethality, poor fertility, hemosiderosis, lymphocyte and spleen anomalies, altered sublingual gland secretion, inflammation of the arteries, lung, liver and thyroid, abnormal spermatogenesis and glomerulosclerosis leading to kidney failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Tk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02082:Tk1 APN 11 117825727 unclassified probably null
IGL02088:Tk1 APN 11 117824665 unclassified probably benign
blowout UTSW 11 117815953 makesense probably null
tica UTSW 11 117817122 unclassified probably benign
tico UTSW 11 117816541 missense probably damaging 1.00
tock UTSW 11 117816494 missense probably damaging 1.00
R0310:Tk1 UTSW 11 117817095 unclassified probably benign
R0811:Tk1 UTSW 11 117822107 missense probably damaging 1.00
R0812:Tk1 UTSW 11 117822107 missense probably damaging 1.00
R1180:Tk1 UTSW 11 117822095 critical splice donor site probably null
R5160:Tk1 UTSW 11 117824746 missense possibly damaging 0.78
R5846:Tk1 UTSW 11 117815922 unclassified probably benign
R5886:Tk1 UTSW 11 117817122 unclassified probably benign
R6862:Tk1 UTSW 11 117816494 missense probably damaging 1.00
R7043:Tk1 UTSW 11 117815953 makesense probably null
R7292:Tk1 UTSW 11 117825777 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCCAGAGCCTAAG -3'
(R):5'- TAGCCTGAATCATGGGGTTTAAAAG -3'

Sequencing Primer
(F):5'- CCACTCCTTGGGCAGAAGTAAG -3'
(R):5'- CTCAAGCTGAAGCATGCTTG -3'
Posted On2016-08-04