Incidental Mutation 'R5287:Opn4'
ID424429
Institutional Source Beutler Lab
Gene Symbol Opn4
Ensembl Gene ENSMUSG00000021799
Gene Nameopsin 4 (melanopsin)
Synonyms
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34590618-34600142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34592937 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 460 (T460A)
Ref Sequence ENSEMBL: ENSMUSP00000022331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000022330] [ENSMUST00000022331] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000168444] [ENSMUST00000227819] [ENSMUST00000228044]
Predicted Effect probably benign
Transcript: ENSMUST00000022327
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022328
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022330
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022331
AA Change: T460A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022331
Gene: ENSMUSG00000021799
AA Change: T460A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 77 324 6.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 80 362 8.3e-13 PFAM
Pfam:7tm_1 86 347 2.9e-58 PFAM
Pfam:7TM_GPCR_Srv 108 362 1.5e-6 PFAM
low complexity region 383 401 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064098
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090040
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168444
SMART Domains Protein: ENSMUSP00000126136
Gene: ENSMUSG00000021799

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 77 324 1.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 80 362 6.1e-13 PFAM
Pfam:7tm_1 86 347 2.6e-64 PFAM
Pfam:7TM_GPCR_Srv 108 362 1.2e-6 PFAM
low complexity region 383 401 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226806
Predicted Effect probably benign
Transcript: ENSMUST00000227819
Predicted Effect probably benign
Transcript: ENSMUST00000228044
Meta Mutation Damage Score 0.014 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene encodes a photoreceptive opsin protein that is expressed within the ganglion and amacrine cell layers of the retina. In mouse, retinal ganglion cell axons expressing this gene projected to the suprachiasmatic nucleus and other brain nuclei involved in circadian photoentrainment. In mouse, this protein is coupled to a transient receptor potential (TRP) ion channel through a G protein signaling pathway and produces a physiologic light response via membrane depolarization and increased intracellular calcium. The protein functions as a sensory photopigment and may also have photoisomerase activity. Experiments with knockout mice indicate that this gene attenuates, but does not abolish, photoentrainment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in absent intrinsic inner retinal photosensitivity, abnormal pupillary reflex, and abnormal circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Opn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Opn4 APN 14 34597209 splice site probably benign
IGL02628:Opn4 APN 14 34593057 missense probably benign 0.15
R0308:Opn4 UTSW 14 34597124 missense possibly damaging 0.79
R0586:Opn4 UTSW 14 34598973 splice site probably benign
R2022:Opn4 UTSW 14 34597071 missense probably benign 0.25
R2860:Opn4 UTSW 14 34593828 critical splice donor site probably null
R2861:Opn4 UTSW 14 34593828 critical splice donor site probably null
R2862:Opn4 UTSW 14 34593828 critical splice donor site probably null
R3976:Opn4 UTSW 14 34597109 missense probably benign 0.12
R4007:Opn4 UTSW 14 34599832 missense probably benign 0.41
R4837:Opn4 UTSW 14 34596304 missense probably damaging 1.00
R5403:Opn4 UTSW 14 34592937 missense probably benign 0.01
R6252:Opn4 UTSW 14 34594831 missense probably benign 0.22
R6991:Opn4 UTSW 14 34593907 missense probably benign 0.38
R7065:Opn4 UTSW 14 34595877 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTGAGAGTCACATCATCCTCTAG -3'
(R):5'- TCTGTGCAGAGGCTTAAGGG -3'

Sequencing Primer
(F):5'- TCCTCTAGGAAAGCAAGGGG -3'
(R):5'- GAGTATGCTCCAAGTAAGCTGTCC -3'
Posted On2016-08-04