Incidental Mutation 'R5288:Olfr457'
ID424476
Institutional Source Beutler Lab
Gene Symbol Olfr457
Ensembl Gene ENSMUSG00000091983
Gene Nameolfactory receptor 457
SynonymsMOR257-1, GA_x6K02T2P3E9-5088893-5089834
MMRRC Submission 042842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5288 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42468015-42476335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42471252 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 309 (I309F)
Ref Sequence ENSEMBL: ENSMUSP00000144914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170504] [ENSMUST00000203396] [ENSMUST00000204324]
Predicted Effect probably benign
Transcript: ENSMUST00000170504
AA Change: I309F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127348
Gene: ENSMUSG00000091983
AA Change: I309F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.4e-53 PFAM
Pfam:7tm_1 41 290 2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203396
AA Change: I309F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145162
Gene: ENSMUSG00000091983
AA Change: I309F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.4e-53 PFAM
Pfam:7tm_1 41 290 2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204324
AA Change: I309F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144914
Gene: ENSMUSG00000091983
AA Change: I309F

DomainStartEndE-ValueType
Pfam:7tm_4 31 125 2.4e-19 PFAM
Pfam:7tm_1 41 125 3.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T G 16: 13,677,758 N240K probably benign Het
Abcc12 A T 8: 86,566,539 Y7N probably damaging Het
Adcy1 A C 11: 7,161,351 I881L probably benign Het
Aftph T C 11: 20,726,994 D205G probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
C87414 C T 5: 93,637,748 M224I possibly damaging Het
Ccdc88a T G 11: 29,498,416 N1465K possibly damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Cfap46 A G 7: 139,613,507 probably null Het
Cftr C T 6: 18,226,129 Q359* probably null Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cntn2 A G 1: 132,523,677 I438T probably benign Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyfip1 A T 7: 55,925,135 M1045L possibly damaging Het
Cyp2c29 C T 19: 39,330,372 P432L probably damaging Het
Dcaf11 T A 14: 55,563,376 D96E probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnhd1 G A 7: 105,714,437 E4069K possibly damaging Het
Dpy19l4 T A 4: 11,289,721 N330I probably damaging Het
Dpy19l4 G T 4: 11,304,014 A132D probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Eml3 G A 19: 8,939,274 G720S probably damaging Het
F11 A G 8: 45,246,796 S418P probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat2 G A 11: 55,267,656 T3412I probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm11787 T C 4: 3,511,795 noncoding transcript Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hephl1 T C 9: 15,076,854 T653A possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ighe T C 12: 113,271,472 H356R probably benign Het
Ighv10-3 T A 12: 114,523,505 M99L probably benign Het
Izumo4 C A 10: 80,702,805 C30* probably null Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kif24 T C 4: 41,395,373 E500G probably benign Het
Kng1 A T 16: 23,079,092 D414V probably damaging Het
Loxhd1 A C 18: 77,363,612 D410A probably damaging Het
Ltn1 T C 16: 87,416,011 K554R possibly damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Ms4a6d A T 19: 11,587,136 S124T possibly damaging Het
Mtfr2 A G 10: 20,357,702 D339G probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Nadsyn1 A G 7: 143,803,286 V491A possibly damaging Het
Nav3 T C 10: 109,853,105 N437S probably benign Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nktr A G 9: 121,748,593 K576E probably benign Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Oas3 A G 5: 120,756,990 F978S probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1331 T C 4: 118,869,575 S264P probably damaging Het
Olfr330 A T 11: 58,529,482 M168K probably damaging Het
Olfr484 T C 7: 108,125,168 T32A probably benign Het
Pcyox1 A T 6: 86,392,354 probably null Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Pou4f2 A G 8: 78,436,329 Y26H unknown Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prdx2 T A 8: 84,971,673 Y164* probably null Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Rab4a A T 8: 123,827,374 I16L probably benign Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rimbp2 G A 5: 128,788,592 T557M probably benign Het
Rmi1 G A 13: 58,409,466 G510R probably damaging Het
Sdad1 A G 5: 92,286,825 *687Q probably null Het
Sema6d T C 2: 124,664,246 L720P probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Strn3 C G 12: 51,648,020 R320P probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne2 T A 12: 76,099,338 S6377T possibly damaging Het
Tas2r123 A T 6: 132,847,227 H29L probably benign Het
Tbl3 C T 17: 24,705,970 V52M possibly damaging Het
Tbp A G 17: 15,507,347 I145V probably benign Het
Tcf20 A T 15: 82,855,709 S514T possibly damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tln1 C T 4: 43,540,661 V1447I probably benign Het
Tnfrsf11b C T 15: 54,278,226 A8T probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tsen15 C T 1: 152,383,380 V76I probably damaging Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vmn2r94 A C 17: 18,244,466 Y521D probably damaging Het
Vps45 T C 3: 96,057,774 M1V probably null Het
Vta1 C A 10: 14,705,399 L21F probably damaging Het
Zdhhc21 C T 4: 82,847,692 G2D probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfp90 C T 8: 106,425,368 T571M probably damaging Het
Zswim8 A T 14: 20,718,871 N1119I possibly damaging Het
Other mutations in Olfr457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Olfr457 APN 6 42472112 missense probably benign 0.00
IGL01915:Olfr457 APN 6 42471289 missense probably benign 0.01
IGL02006:Olfr457 APN 6 42472091 missense probably benign 0.37
IGL02440:Olfr457 APN 6 42472166 missense probably benign
R0024:Olfr457 UTSW 6 42471260 missense probably benign
R0662:Olfr457 UTSW 6 42471774 missense possibly damaging 0.75
R1599:Olfr457 UTSW 6 42471242 missense probably damaging 1.00
R2087:Olfr457 UTSW 6 42472051 missense probably damaging 1.00
R5002:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R5022:Olfr457 UTSW 6 42471287 missense possibly damaging 0.92
R5342:Olfr457 UTSW 6 42471902 missense probably damaging 1.00
R5823:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R5824:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R6378:Olfr457 UTSW 6 42471753 missense probably benign 0.01
X0017:Olfr457 UTSW 6 42471818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACACTTAAGGGCAGGTTATATG -3'
(R):5'- CGCAAAGCCTTTGAGACCTG -3'

Sequencing Primer
(F):5'- TATGAATGGCTCATACCCCAGGAG -3'
(R):5'- AAGCCTTTGAGACCTGTGCCTC -3'
Posted On2016-08-04