Incidental Mutation 'R0491:Clcn1'
ID42460
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R0491 (G1)
Quality Score218
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42310581 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 740 (F740L)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably benign
Transcript: ENSMUST00000031891
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031894
AA Change: F740L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: F740L

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095974
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143278
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163235
AA Change: F28L
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862
AA Change: F28L

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: F668L
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: F668L

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169902
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCCAGTAGGTGTCGCCAG -3'
(R):5'- GCCTCACATCTCCTTACAAGAGCAG -3'

Sequencing Primer
(F):5'- tgggctgggctTTGCTAAG -3'
(R):5'- GCTCTTAGGGAAAGGTGAGTCC -3'
Posted On2013-05-23