Incidental Mutation 'R5290:Spen'
ID424644
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141473816 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2500 (T2500I)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably damaging
Transcript: ENSMUST00000078886
AA Change: T2477I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T2477I

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105786
AA Change: T2500I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T2500I

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense not run
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGGATGCTTAGGGTCACAG -3'
(R):5'- CAGGTTCAAGGTGCACTCGATC -3'

Sequencing Primer
(F):5'- ACTCACGGGCTCTGCAATG -3'
(R):5'- ATCATCGAGAGTGACCCTGTGAC -3'
Posted On2016-08-04