Incidental Mutation 'R5290:Itpr1'
ID424649
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission 042873-MU
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108406145 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1478 (V1478A)
Ref Sequence ENSEMBL: ENSMUSP00000144880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: V1478A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V1478A

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203615
AA Change: V1478A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V1478A

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GACTTCCTGTTCCACACTGAAATC -3'
(R):5'- TGACAGAGCCACCTTCCATTC -3'

Sequencing Primer
(F):5'- CATGATCATCTGTTATACACTGTGGC -3'
(R):5'- CCATTCTGGCTTTGCAGAATG -3'
Posted On2016-08-04