Incidental Mutation 'R5382:Cluh'
ID424800
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 74665109 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
Predicted Effect probably benign
Transcript: ENSMUST00000092915
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117818
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 unclassified probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACCAGCTGGACCACATTTATGTG -3'
(R):5'- AGTGTTGTCTGCAGCTCCTG -3'

Sequencing Primer
(F):5'- ACATTTATGTGAGTGGGGCTTG -3'
(R):5'- TTCTTGGAGAGCAGCTCATCAGC -3'
Posted On2016-08-04