Incidental Mutation 'R5383:Muc2'
ID 424847
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 042958-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R5383 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141307456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 804 (C804R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: C365R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: C365R

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187945
AA Change: C804R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,211,532 (GRCm39) Y227F possibly damaging Het
Aadac T C 3: 59,943,496 (GRCm39) probably benign Het
Abl2 G A 1: 156,469,802 (GRCm39) G918E possibly damaging Het
Acvr1c T C 2: 58,177,747 (GRCm39) T241A probably damaging Het
Adck1 T C 12: 88,422,373 (GRCm39) V328A probably benign Het
Ano6 A G 15: 95,813,918 (GRCm39) I279V probably benign Het
AW551984 T A 9: 39,501,994 (GRCm39) Y704F probably benign Het
C1s1 T C 6: 124,511,360 (GRCm39) D321G probably damaging Het
Cacna1d T A 14: 29,767,236 (GRCm39) D1910V possibly damaging Het
Cdh5 A G 8: 104,864,479 (GRCm39) Q480R probably benign Het
Cdhr1 C T 14: 36,810,964 (GRCm39) V266M possibly damaging Het
Cdk5rap1 A T 2: 154,192,755 (GRCm39) V414D possibly damaging Het
Ctdnep1 T A 11: 69,875,222 (GRCm39) probably benign Het
Cyfip2 T C 11: 46,168,918 (GRCm39) M212V possibly damaging Het
D130043K22Rik G A 13: 25,041,397 (GRCm39) S273N probably benign Het
Ddi2 A G 4: 141,412,163 (GRCm39) S250P probably damaging Het
Dennd1b A G 1: 139,095,409 (GRCm39) T486A probably benign Het
Disc1 A G 8: 125,862,196 (GRCm39) T523A probably damaging Het
Dmbx1 A G 4: 115,775,342 (GRCm39) S313P probably damaging Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
Dnah11 T C 12: 118,049,432 (GRCm39) E1664G probably damaging Het
Dpysl3 A T 18: 43,571,103 (GRCm39) V57E probably damaging Het
Fam98a C T 17: 75,845,576 (GRCm39) G390E unknown Het
Hook3 C A 8: 26,609,017 (GRCm39) R9L probably benign Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Impg2 A G 16: 56,063,989 (GRCm39) D298G probably benign Het
Inf2 T A 12: 112,566,579 (GRCm39) V48D probably damaging Het
Itprid1 T A 6: 55,955,275 (GRCm39) L961H probably benign Het
Kcnh1 G A 1: 192,187,999 (GRCm39) G820D probably benign Het
Lsm14a C T 7: 34,088,789 (GRCm39) A39T possibly damaging Het
Nim1k C T 13: 120,189,335 (GRCm39) V25M probably benign Het
Or11g25 T A 14: 50,723,509 (GRCm39) L198* probably null Het
Or4a73 T C 2: 89,421,457 (GRCm39) M1V probably null Het
Or5b122 T A 19: 13,563,439 (GRCm39) M257K probably damaging Het
Or6c68 A G 10: 129,158,205 (GRCm39) T238A probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Phf8-ps T C 17: 33,284,231 (GRCm39) D857G probably benign Het
Pitrm1 T A 13: 6,627,468 (GRCm39) H856Q probably damaging Het
Pkd1 T C 17: 24,793,349 (GRCm39) C1679R probably benign Het
Pkp4 T A 2: 59,140,617 (GRCm39) L441* probably null Het
Ppp4r4 T C 12: 103,550,427 (GRCm39) F284L probably benign Het
Ptprt T A 2: 161,539,969 (GRCm39) K769M probably damaging Het
Rbm12 G T 2: 155,945,285 (GRCm39) probably benign Het
Rpf1 T C 3: 146,225,146 (GRCm39) D94G possibly damaging Het
Scap G T 9: 110,203,597 (GRCm39) K310N probably damaging Het
Smpd2 C T 10: 41,364,698 (GRCm39) probably benign Het
Sp110 TC TCC 1: 85,519,290 (GRCm39) probably null Het
Specc1l T A 10: 75,082,539 (GRCm39) I662N possibly damaging Het
Sptan1 T A 2: 29,901,340 (GRCm39) V1496D probably damaging Het
Srrm4 T C 5: 116,609,319 (GRCm39) probably benign Het
Taf2 A G 15: 54,912,815 (GRCm39) I515T possibly damaging Het
Tdrd3 C T 14: 87,718,227 (GRCm39) Q203* probably null Het
Tfap2b A T 1: 19,296,722 (GRCm39) M222L probably benign Het
Tmem43 G A 6: 91,450,872 (GRCm39) A2T probably benign Het
Trav9-1 T A 14: 53,725,833 (GRCm39) I49N probably benign Het
Trim23 T G 13: 104,335,205 (GRCm39) N410K probably damaging Het
Ttbk1 T C 17: 46,778,342 (GRCm39) T567A probably damaging Het
Unc79 A G 12: 103,070,886 (GRCm39) N1081S possibly damaging Het
Zfp451 A C 1: 33,852,887 (GRCm39) I9R probably damaging Het
Zfp563 T A 17: 33,323,681 (GRCm39) M92K probably benign Het
Zfp618 G A 4: 63,013,729 (GRCm39) G198D probably benign Het
Zfp637 G T 6: 117,820,270 (GRCm39) probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CTGTCCATGTATGCGTTGCC -3'
(R):5'- CTTTGAGGAACTGAGTCCCAAC -3'

Sequencing Primer
(F):5'- CCATGTATGCGTTGCCAGGAG -3'
(R):5'- TGAGTCCCAACATGCAGCTG -3'
Posted On 2016-08-04