Incidental Mutation 'R5384:Ppp1r42'
ID424884
Institutional Source Beutler Lab
Gene Symbol Ppp1r42
Ensembl Gene ENSMUSG00000025916
Gene Nameprotein phosphatase 1, regulatory subunit 42
Synonyms1700011J18Rik, 4930418G15Rik, Lrrc67
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location9968624-10009136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9999435 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 134 (L134P)
Ref Sequence ENSEMBL: ENSMUSP00000115030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027049] [ENSMUST00000124874] [ENSMUST00000130102] [ENSMUST00000176398]
Predicted Effect probably damaging
Transcript: ENSMUST00000027049
AA Change: L134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027049
Gene: ENSMUSG00000025916
AA Change: L134P

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2.5e-8 PFAM
Pfam:LRR_4 72 114 2.3e-11 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
low complexity region 323 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124874
AA Change: L134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115309
Gene: ENSMUSG00000025916
AA Change: L134P

DomainStartEndE-ValueType
Pfam:LRR_8 50 106 2e-8 PFAM
Pfam:LRR_6 71 94 5.9e-3 PFAM
Pfam:LRR_4 72 117 3.8e-11 PFAM
Pfam:LRR_8 72 128 1.3e-8 PFAM
Pfam:LRR_1 73 93 3.4e-3 PFAM
Pfam:LRR_6 145 172 2.2e-3 PFAM
low complexity region 184 201 N/A INTRINSIC
low complexity region 243 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130102
AA Change: L134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115030
Gene: ENSMUSG00000025916
AA Change: L134P

DomainStartEndE-ValueType
Pfam:LRR_6 49 68 4.4e-2 PFAM
Pfam:LRR_8 50 106 2.3e-8 PFAM
Pfam:LRR_6 71 95 6.8e-3 PFAM
Pfam:LRR_4 72 116 6.9e-11 PFAM
Pfam:LRR_8 72 128 1.5e-8 PFAM
Pfam:LRR_1 73 93 5.1e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155163
Predicted Effect probably benign
Transcript: ENSMUST00000176398
SMART Domains Protein: ENSMUSP00000135276
Gene: ENSMUSG00000025916

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Adamts9 A C 6: 92,798,018 C1090W probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fat4 T C 3: 38,995,946 S3986P possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Il23r G A 6: 67,486,291 H73Y probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Lrwd1 A T 5: 136,123,874 D511E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Svep1 T C 4: 58,104,545 K1226R possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Ppp1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Ppp1r42 APN 1 10003233 critical splice donor site probably null
IGL02739:Ppp1r42 APN 1 9968853 missense probably benign 0.34
R0920:Ppp1r42 UTSW 1 9999525 missense probably damaging 1.00
R1829:Ppp1r42 UTSW 1 10000086 missense probably benign 0.00
R2151:Ppp1r42 UTSW 1 10003347 missense probably benign 0.10
R2909:Ppp1r42 UTSW 1 10003412 intron probably benign
R4828:Ppp1r42 UTSW 1 9999411 missense probably benign
R4863:Ppp1r42 UTSW 1 10003386 intron probably benign
R5394:Ppp1r42 UTSW 1 9999405 missense probably damaging 1.00
R6725:Ppp1r42 UTSW 1 9999507 missense probably damaging 1.00
R7343:Ppp1r42 UTSW 1 9968857 missense probably benign
R7556:Ppp1r42 UTSW 1 9995183 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTCGCCTAGCCTGAATACTTC -3'
(R):5'- GTATTTCACAGCCTCAAAGTCAC -3'

Sequencing Primer
(F):5'- AACTAACATGGAGGGCCTGCTC -3'
(R):5'- GCCTCAAAGTCACATCGTTCTCAG -3'
Posted On2016-08-04