Incidental Mutation 'R0491:Col11a2'
ID42502
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R0491 (G1)
Quality Score205
Status Validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34042212 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 45 (D45E)
Ref Sequence ENSEMBL: ENSMUSP00000122082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044858] [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000116612] [ENSMUST00000131134] [ENSMUST00000173354]
Predicted Effect probably benign
Transcript: ENSMUST00000044858
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087497
AA Change: D45E
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: D45E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114252
AA Change: D45E
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: D45E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114255
AA Change: D45E
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: D45E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116612
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131134
AA Change: D45E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: D45E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173354
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174033
Predicted Effect probably benign
Transcript: ENSMUST00000174299
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174645
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCGAGTCTGAGACACAGATGCTG -3'
(R):5'- GAGAGAAGTCTTTGGGAAAGCCTCC -3'

Sequencing Primer
(F):5'- CTGAGACACAGATGCTGACAGAG -3'
(R):5'- GTACCCCAGAGAGAGACACAC -3'
Posted On2013-05-23