Incidental Mutation 'R5385:Sspo'
ID425067
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene NameSCO-spondin
SynonymsScospondin, C79529
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5385 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48448229-48501250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48462253 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1612 (P1612S)
Ref Sequence ENSEMBL: ENSMUSP00000131401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]
Predicted Effect probably benign
Transcript: ENSMUST00000043676
AA Change: P1487S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: P1487S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169350
AA Change: P1612S

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: P1612S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212740
AA Change: P1612S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Arhgap30 A G 1: 171,408,280 R741G probably benign Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48470453 missense probably benign 0.02
IGL00339:Sspo APN 6 48483746 splice site probably benign
IGL00391:Sspo APN 6 48497386 missense probably damaging 0.96
IGL00433:Sspo APN 6 48490036 missense probably damaging 1.00
IGL00471:Sspo APN 6 48498213 splice site probably benign
IGL00500:Sspo APN 6 48497421 nonsense probably null
IGL00537:Sspo APN 6 48498213 splice site probably benign
IGL00540:Sspo APN 6 48498213 splice site probably benign
IGL01060:Sspo APN 6 48449479 nonsense probably null
IGL01090:Sspo APN 6 48490125 missense probably benign 0.08
IGL01125:Sspo APN 6 48492888 missense probably damaging 1.00
IGL01447:Sspo APN 6 48464666 splice site probably null
IGL01457:Sspo APN 6 48498343 missense probably benign 0.00
IGL01481:Sspo APN 6 48448515 missense probably benign 0.41
IGL01485:Sspo APN 6 48478731 missense probably damaging 1.00
IGL01544:Sspo APN 6 48491019 missense probably damaging 0.99
IGL01575:Sspo APN 6 48459042 missense probably benign 0.01
IGL01589:Sspo APN 6 48451178 missense probably damaging 1.00
IGL01601:Sspo APN 6 48486379 missense probably benign 0.33
IGL01644:Sspo APN 6 48452502 missense probably benign
IGL01659:Sspo APN 6 48474443 missense probably damaging 1.00
IGL01801:Sspo APN 6 48457138 missense probably damaging 1.00
IGL01872:Sspo APN 6 48454689 missense probably damaging 0.99
IGL01874:Sspo APN 6 48452190 missense probably damaging 1.00
IGL01936:Sspo APN 6 48475887 missense probably damaging 1.00
IGL01941:Sspo APN 6 48495182 missense probably benign 0.19
IGL01986:Sspo APN 6 48483303 missense probably benign 0.05
IGL01987:Sspo APN 6 48477624 splice site probably null
IGL02170:Sspo APN 6 48467983 missense possibly damaging 0.76
IGL02192:Sspo APN 6 48459568 missense possibly damaging 0.86
IGL02210:Sspo APN 6 48500492 missense probably damaging 1.00
IGL02225:Sspo APN 6 48484334 missense probably benign 0.09
IGL02280:Sspo APN 6 48496231 missense probably damaging 1.00
IGL02303:Sspo APN 6 48484705 missense possibly damaging 0.52
IGL02397:Sspo APN 6 48461638 missense probably benign 0.35
IGL02451:Sspo APN 6 48460303 splice site probably benign
IGL02500:Sspo APN 6 48478379 nonsense probably null
IGL02519:Sspo APN 6 48484828 missense probably damaging 1.00
IGL02549:Sspo APN 6 48451773 missense possibly damaging 0.81
IGL02562:Sspo APN 6 48490122 unclassified probably null
IGL02673:Sspo APN 6 48475860 missense probably damaging 1.00
IGL02673:Sspo APN 6 48498775 critical splice donor site probably null
IGL02719:Sspo APN 6 48482667 missense probably benign 0.39
IGL02793:Sspo APN 6 48487894 splice site probably benign
IGL03003:Sspo APN 6 48455087 missense probably damaging 0.98
IGL03056:Sspo APN 6 48470538 missense probably benign 0.17
IGL03105:Sspo APN 6 48473658 splice site probably benign
IGL03116:Sspo APN 6 48494101 missense probably benign 0.32
IGL03163:Sspo APN 6 48484332 missense probably benign 0.19
IGL03198:Sspo APN 6 48477582 missense probably benign 0.31
IGL03365:Sspo APN 6 48459415 missense possibly damaging 0.82
Barrier UTSW 6 48495212 missense possibly damaging 0.58
ANU74:Sspo UTSW 6 48460959 missense probably damaging 1.00
IGL02984:Sspo UTSW 6 48495155 missense probably benign 0.33
IGL03052:Sspo UTSW 6 48460453 missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48451065 missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48481239 missense probably benign
R0087:Sspo UTSW 6 48477785 missense probably damaging 1.00
R0122:Sspo UTSW 6 48473976 missense possibly damaging 0.95
R0129:Sspo UTSW 6 48455418 missense probably benign 0.00
R0164:Sspo UTSW 6 48494194 splice site probably benign
R0195:Sspo UTSW 6 48486636 missense probably benign
R0200:Sspo UTSW 6 48486415 missense probably null 0.01
R0201:Sspo UTSW 6 48455752 missense possibly damaging 0.64
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0243:Sspo UTSW 6 48493186 missense probably damaging 1.00
R0268:Sspo UTSW 6 48465555 missense probably benign 0.26
R0312:Sspo UTSW 6 48455401 missense possibly damaging 0.52
R0449:Sspo UTSW 6 48466740 missense probably damaging 1.00
R0523:Sspo UTSW 6 48451860 missense probably benign 0.20
R0576:Sspo UTSW 6 48464942 splice site probably null
R0671:Sspo UTSW 6 48490391 splice site probably benign
R0828:Sspo UTSW 6 48498734 missense probably damaging 1.00
R0880:Sspo UTSW 6 48475935 missense possibly damaging 0.69
R0903:Sspo UTSW 6 48455308 critical splice acceptor site probably null
R1051:Sspo UTSW 6 48491455 nonsense probably null
R1083:Sspo UTSW 6 48470999 missense possibly damaging 0.91
R1109:Sspo UTSW 6 48497443 missense probably damaging 1.00
R1118:Sspo UTSW 6 48459418 missense probably damaging 0.97
R1256:Sspo UTSW 6 48457639 missense probably damaging 1.00
R1342:Sspo UTSW 6 48461635 missense probably benign 0.07
R1355:Sspo UTSW 6 48448626 missense probably benign 0.41
R1370:Sspo UTSW 6 48448626 missense probably benign 0.41
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1476:Sspo UTSW 6 48463400 critical splice donor site probably null
R1566:Sspo UTSW 6 48466870 critical splice donor site probably null
R1630:Sspo UTSW 6 48457724 missense probably benign 0.01
R1686:Sspo UTSW 6 48460400 missense probably benign 0.00
R1707:Sspo UTSW 6 48477877 missense probably damaging 0.99
R1727:Sspo UTSW 6 48494848 missense probably damaging 1.00
R1822:Sspo UTSW 6 48492886 missense possibly damaging 0.75
R1831:Sspo UTSW 6 48489786 missense probably damaging 1.00
R1835:Sspo UTSW 6 48457340 missense probably damaging 0.97
R1862:Sspo UTSW 6 48491006 missense probably damaging 0.98
R1878:Sspo UTSW 6 48459366 missense possibly damaging 0.92
R1900:Sspo UTSW 6 48459350 missense probably benign 0.22
R1945:Sspo UTSW 6 48489773 missense possibly damaging 0.93
R1957:Sspo UTSW 6 48478273 missense probably damaging 0.99
R1990:Sspo UTSW 6 48451050 missense probably benign 0.00
R1996:Sspo UTSW 6 48475490 missense possibly damaging 0.50
R2049:Sspo UTSW 6 48460763 splice site probably benign
R2049:Sspo UTSW 6 48463531 missense probably benign 0.36
R2064:Sspo UTSW 6 48473662 missense probably damaging 0.99
R2072:Sspo UTSW 6 48473517 missense probably benign 0.01
R2096:Sspo UTSW 6 48461674 missense probably benign
R2106:Sspo UTSW 6 48466316 missense possibly damaging 0.96
R2230:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2230:Sspo UTSW 6 48500503 missense probably benign 0.11
R2232:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2351:Sspo UTSW 6 48464869 missense probably damaging 1.00
R2423:Sspo UTSW 6 48454055 missense probably benign 0.00
R2508:Sspo UTSW 6 48464364 missense probably damaging 1.00
R3110:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3112:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3413:Sspo UTSW 6 48480697 missense probably damaging 1.00
R3433:Sspo UTSW 6 48475951 splice site probably null
R3498:Sspo UTSW 6 48467980 missense possibly damaging 0.58
R3732:Sspo UTSW 6 48449930 missense probably damaging 1.00
R3816:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3818:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3819:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3838:Sspo UTSW 6 48480820 missense probably damaging 1.00
R3850:Sspo UTSW 6 48492490 missense probably damaging 1.00
R3880:Sspo UTSW 6 48494940 missense probably benign 0.38
R3893:Sspo UTSW 6 48476571 nonsense probably null
R4116:Sspo UTSW 6 48456994 missense probably damaging 0.99
R4179:Sspo UTSW 6 48498395 critical splice donor site probably null
R4180:Sspo UTSW 6 48498395 critical splice donor site probably null
R4207:Sspo UTSW 6 48478293 missense probably benign 0.00
R4210:Sspo UTSW 6 48464901 missense probably benign 0.00
R4223:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4224:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4225:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4229:Sspo UTSW 6 48490934 missense probably benign 0.00
R4230:Sspo UTSW 6 48490934 missense probably benign 0.00
R4363:Sspo UTSW 6 48498731 missense probably damaging 1.00
R4370:Sspo UTSW 6 48466348 missense probably null 0.14
R4407:Sspo UTSW 6 48460520 missense probably damaging 1.00
R4438:Sspo UTSW 6 48487353 missense probably damaging 1.00
R4454:Sspo UTSW 6 48487225 missense probably benign 0.05
R4455:Sspo UTSW 6 48465516 missense probably damaging 1.00
R4561:Sspo UTSW 6 48475534 splice site probably null
R4574:Sspo UTSW 6 48465523 missense probably damaging 1.00
R4578:Sspo UTSW 6 48463373 missense possibly damaging 0.58
R4653:Sspo UTSW 6 48478646 missense probably damaging 1.00
R4656:Sspo UTSW 6 48454076 missense possibly damaging 0.65
R4659:Sspo UTSW 6 48484213 missense probably damaging 1.00
R4664:Sspo UTSW 6 48473534 missense possibly damaging 0.82
R4685:Sspo UTSW 6 48492894 missense probably damaging 0.98
R4692:Sspo UTSW 6 48482687 missense probably damaging 1.00
R4703:Sspo UTSW 6 48500453 missense probably damaging 1.00
R4704:Sspo UTSW 6 48498704 missense probably damaging 1.00
R4738:Sspo UTSW 6 48478396 missense possibly damaging 0.78
R4766:Sspo UTSW 6 48470580 missense probably benign 0.04
R4771:Sspo UTSW 6 48460879 missense probably damaging 1.00
R4790:Sspo UTSW 6 48460771 missense probably benign 0.04
R4792:Sspo UTSW 6 48461585 missense probably benign 0.00
R4808:Sspo UTSW 6 48451161 missense probably damaging 1.00
R4812:Sspo UTSW 6 48490510 missense probably benign 0.00
R4883:Sspo UTSW 6 48460822 missense probably benign 0.00
R4906:Sspo UTSW 6 48465730 critical splice acceptor site probably null
R4934:Sspo UTSW 6 48465552 missense probably damaging 1.00
R4945:Sspo UTSW 6 48467087 splice site probably null
R4967:Sspo UTSW 6 48464605 missense probably damaging 0.97
R5016:Sspo UTSW 6 48452280 nonsense probably null
R5018:Sspo UTSW 6 48455700 missense probably damaging 1.00
R5034:Sspo UTSW 6 48480823 missense possibly damaging 0.93
R5044:Sspo UTSW 6 48466955 critical splice acceptor site probably null
R5055:Sspo UTSW 6 48464795 missense probably damaging 1.00
R5087:Sspo UTSW 6 48488471 missense possibly damaging 0.51
R5155:Sspo UTSW 6 48460474 missense probably benign 0.03
R5223:Sspo UTSW 6 48478324 missense probably damaging 1.00
R5249:Sspo UTSW 6 48493310 missense probably damaging 0.98
R5257:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5258:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5276:Sspo UTSW 6 48490467 missense probably damaging 1.00
R5307:Sspo UTSW 6 48454850 missense probably damaging 0.99
R5341:Sspo UTSW 6 48459615 missense probably damaging 1.00
R5361:Sspo UTSW 6 48466313 missense probably benign 0.02
R5394:Sspo UTSW 6 48495260 missense possibly damaging 0.52
R5477:Sspo UTSW 6 48498393 missense possibly damaging 0.60
R5490:Sspo UTSW 6 48493280 missense probably benign 0.33
R5512:Sspo UTSW 6 48455671 missense probably damaging 0.97
R5518:Sspo UTSW 6 48496654 missense possibly damaging 0.92
R5530:Sspo UTSW 6 48465583 missense probably damaging 0.97
R5538:Sspo UTSW 6 48452178 missense probably damaging 0.99
R5590:Sspo UTSW 6 48474491 missense probably damaging 1.00
R5613:Sspo UTSW 6 48455044 missense possibly damaging 0.79
R5638:Sspo UTSW 6 48492891 missense possibly damaging 0.86
R5809:Sspo UTSW 6 48460045 missense possibly damaging 0.59
R5810:Sspo UTSW 6 48483898 missense probably benign 0.02
R5814:Sspo UTSW 6 48451884 missense probably damaging 1.00
R5915:Sspo UTSW 6 48464596 missense probably benign 0.00
R5915:Sspo UTSW 6 48491484 missense possibly damaging 0.83
R5979:Sspo UTSW 6 48463693 missense probably benign 0.20
R5996:Sspo UTSW 6 48494176 missense possibly damaging 0.87
R6012:Sspo UTSW 6 48451371 missense probably benign 0.00
R6025:Sspo UTSW 6 48486786 missense possibly damaging 0.83
R6120:Sspo UTSW 6 48465576 missense probably damaging 1.00
R6150:Sspo UTSW 6 48486379 missense probably benign 0.33
R6221:Sspo UTSW 6 48463705 missense probably damaging 1.00
R6261:Sspo UTSW 6 48462191 missense possibly damaging 0.75
R6312:Sspo UTSW 6 48457366 critical splice donor site probably null
R6372:Sspo UTSW 6 48472541 missense probably damaging 1.00
R6456:Sspo UTSW 6 48451806 missense probably benign 0.08
R6497:Sspo UTSW 6 48495208 missense possibly damaging 0.71
R6501:Sspo UTSW 6 48495212 missense possibly damaging 0.58
R6617:Sspo UTSW 6 48491046 missense possibly damaging 0.93
R6825:Sspo UTSW 6 48465525 missense probably benign 0.04
R6831:Sspo UTSW 6 48484833 missense possibly damaging 0.68
R6861:Sspo UTSW 6 48487955 missense probably benign 0.15
R6961:Sspo UTSW 6 48463877 missense probably benign 0.05
R6967:Sspo UTSW 6 48489794 missense probably benign 0.21
R7016:Sspo UTSW 6 48449164 missense probably damaging 1.00
R7035:Sspo UTSW 6 48449213 intron probably null
R7058:Sspo UTSW 6 48448582 missense probably damaging 1.00
R7072:Sspo UTSW 6 48454979 missense probably damaging 1.00
R7078:Sspo UTSW 6 48460379 missense probably damaging 1.00
R7082:Sspo UTSW 6 48478609 critical splice acceptor site probably null
R7120:Sspo UTSW 6 48465571 missense probably benign 0.05
R7127:Sspo UTSW 6 48449512 missense probably benign 0.02
R7146:Sspo UTSW 6 48501095 missense probably benign 0.15
R7220:Sspo UTSW 6 48476606 nonsense probably null
R7242:Sspo UTSW 6 48473952 missense probably benign
R7261:Sspo UTSW 6 48450077 missense possibly damaging 0.52
R7313:Sspo UTSW 6 48454828 missense probably damaging 1.00
R7313:Sspo UTSW 6 48473456 missense probably benign 0.04
R7323:Sspo UTSW 6 48461647 missense possibly damaging 0.93
R7330:Sspo UTSW 6 48475462 missense probably benign 0.00
R7351:Sspo UTSW 6 48464921 missense possibly damaging 0.89
R7467:Sspo UTSW 6 48486303 missense probably damaging 1.00
R7475:Sspo UTSW 6 48455860 missense probably benign 0.37
R7489:Sspo UTSW 6 48473713 missense probably damaging 0.99
X0060:Sspo UTSW 6 48466294 missense probably damaging 1.00
X0060:Sspo UTSW 6 48480794 missense probably damaging 1.00
X0063:Sspo UTSW 6 48497422 missense probably damaging 0.96
X0065:Sspo UTSW 6 48461684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTCGCTGGTCTAAGCAACAC -3'
(R):5'- TGATATCCCCAGCCACAGTC -3'

Sequencing Primer
(F):5'- GGTCTAAGCAACACATTCTCTG -3'
(R):5'- CACAGCATGGGCCAGTCAATG -3'
Posted On2016-08-04