Incidental Mutation 'R5385:Sorl1'
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R5385 (G1)
Quality Score225
Status Not validated
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42057284 bp
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: T558A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: T558A

signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Arhgap30 A G 1: 171,408,280 R741G probably benign Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sspo C T 6: 48,462,253 P1612S probably benign Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04