Incidental Mutation 'R5385:Syne1'
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5385 (G1)
Quality Score222
Status Not validated
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5041494 bp
Amino Acid Change Valine to Isoleucine at position 557 (V557I)
Ref Sequence ENSEMBL: ENSMUSP00000093587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095899] [ENSMUST00000215295]
Predicted Effect probably benign
Transcript: ENSMUST00000095899
AA Change: V557I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093587
Gene: ENSMUSG00000096054
AA Change: V557I

SPEC 43 150 6.95e-13 SMART
SPEC 157 259 1.55e-10 SMART
SPEC 266 366 3.4e-16 SMART
low complexity region 372 386 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
coiled coil region 483 505 N/A INTRINSIC
SPEC 595 698 6.9e-17 SMART
SPEC 705 809 8.82e-1 SMART
low complexity region 811 826 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
KASH 892 949 5.15e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215295
AA Change: V8407I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Arhgap30 A G 1: 171,408,280 R741G probably benign Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Sspo C T 6: 48,462,253 P1612S probably benign Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site unknown
R7529:Syne1 UTSW 10 5424382 missense not run
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04