Incidental Mutation 'R5386:Drosha'
ID425282
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5386 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12842121 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 337 (I337V)
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect probably benign
Transcript: ENSMUST00000090292
AA Change: I337V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150211
Predicted Effect probably benign
Transcript: ENSMUST00000169061
AA Change: I337V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198820
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 E143* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Lrp1 A T 10: 127,592,114 V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
Ryr1 A T 7: 29,117,416 I65N probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAGTGCAGGCTAGGCTTTGG -3'
(R):5'- CCTGCTTGGAGAACGACTTC -3'

Sequencing Primer
(F):5'- AAACACATTTTATTTTGGCAAAGCAG -3'
(R):5'- TTGGAGAACGACTTCAAAAGGATG -3'
Posted On2016-08-04