Incidental Mutation 'R5387:Sec61a2'
ID425309
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene NameSec61, alpha subunit 2 (S. cerevisiae)
Synonyms
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5870987-5895432 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 5882545 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026926] [ENSMUST00000102981] [ENSMUST00000193792]
Predicted Effect probably benign
Transcript: ENSMUST00000026926
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102981
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148745
Predicted Effect probably benign
Transcript: ENSMUST00000193792
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194565
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5872020 missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5886552 missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5891363 splice site probably benign
IGL02608:Sec61a2 APN 2 5874262 missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5882878 nonsense probably null
IGL03271:Sec61a2 APN 2 5882934 nonsense probably null
IGL03294:Sec61a2 APN 2 5876465 unclassified probably null
R0413:Sec61a2 UTSW 2 5876354 intron probably benign
R0742:Sec61a2 UTSW 2 5876548 missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5886534 missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5873736 splice site probably benign
R2680:Sec61a2 UTSW 2 5873745 missense probably benign 0.00
R3522:Sec61a2 UTSW 2 5893216 missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5879625 utr 3 prime probably null
R4405:Sec61a2 UTSW 2 5882859 missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5873693 intron probably benign
R5530:Sec61a2 UTSW 2 5882650 nonsense probably null
R5546:Sec61a2 UTSW 2 5876540 missense possibly damaging 0.78
R5775:Sec61a2 UTSW 2 5882774 intron probably null
R5922:Sec61a2 UTSW 2 5874323 missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5886557 missense probably benign 0.00
R6681:Sec61a2 UTSW 2 5876408 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAGCAGCATCTGTTACAGTG -3'
(R):5'- TCAATGGAGCCCAGAAATGTG -3'

Sequencing Primer
(F):5'- CTGTTACAGTGACAGACTATGAAGC -3'
(R):5'- GCCCAGAAATGTGAGCGATC -3'
Posted On2016-08-04