Incidental Mutation 'R5387:Ubap2l'
ID425317
Institutional Source Beutler Lab
Gene Symbol Ubap2l
Ensembl Gene ENSMUSG00000042520
Gene Nameubiquitin-associated protein 2-like
SynonymsA430103N23Rik, NICE-4, 3110083O19Rik, 4932431F02Rik
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90000140-90052628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90006596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 975 (Y975C)
Ref Sequence ENSEMBL: ENSMUSP00000088424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000090908] [ENSMUST00000195995] [ENSMUST00000196843] [ENSMUST00000198322] [ENSMUST00000199050] [ENSMUST00000199834]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090908
AA Change: Y975C

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520
AA Change: Y975C

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183442
Predicted Effect unknown
Transcript: ENSMUST00000195995
AA Change: Y1006C
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520
AA Change: Y1006C

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197177
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000199834
AA Change: Y1006C
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520
AA Change: Y1006C

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased female body size and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Ubap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2l APN 3 90009256 nonsense probably null
IGL02606:Ubap2l APN 3 90038428 missense probably damaging 0.98
IGL02809:Ubap2l APN 3 90021246 missense probably damaging 1.00
panhandle UTSW 3 90031376 splice site probably benign
plainview UTSW 3 90038850 missense probably damaging 1.00
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0128:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0130:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0502:Ubap2l UTSW 3 90009213 missense probably damaging 1.00
R0619:Ubap2l UTSW 3 90017220 missense probably benign 0.01
R0726:Ubap2l UTSW 3 90021246 missense probably damaging 1.00
R1023:Ubap2l UTSW 3 90047873 utr 5 prime probably benign
R1172:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1174:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1175:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1191:Ubap2l UTSW 3 90023575 missense probably damaging 1.00
R1432:Ubap2l UTSW 3 90019328 missense probably benign 0.11
R1582:Ubap2l UTSW 3 90034671 missense probably damaging 1.00
R1771:Ubap2l UTSW 3 90019231 missense probably damaging 1.00
R2058:Ubap2l UTSW 3 90031376 splice site probably benign
R2059:Ubap2l UTSW 3 90031376 splice site probably benign
R2081:Ubap2l UTSW 3 90038964 missense possibly damaging 0.92
R2408:Ubap2l UTSW 3 90009132 missense probably null 0.99
R3404:Ubap2l UTSW 3 90038850 missense probably damaging 1.00
R3551:Ubap2l UTSW 3 90015451 missense unknown
R4132:Ubap2l UTSW 3 90009184 missense probably damaging 1.00
R4782:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R4798:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R5173:Ubap2l UTSW 3 90021030 missense possibly damaging 0.86
R5274:Ubap2l UTSW 3 90012730 missense probably damaging 1.00
R6548:Ubap2l UTSW 3 90023560 missense probably damaging 1.00
R6912:Ubap2l UTSW 3 90038848 missense possibly damaging 0.84
R6995:Ubap2l UTSW 3 90009241 missense probably damaging 0.98
R7039:Ubap2l UTSW 3 90002355 missense probably damaging 1.00
R7323:Ubap2l UTSW 3 90015406 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTCAAAAGCCCAGAAGGTATCC -3'
(R):5'- AGGTATTGGCGGTCCAGTTAC -3'

Sequencing Primer
(F):5'- GTATCCACCAACTCATTTCCCCAAG -3'
(R):5'- GGAATCTGATTCTGAAACTTCTAGC -3'
Posted On2016-08-04