Incidental Mutation 'R5387:Aup1'
ID425329
Institutional Source Beutler Lab
Gene Symbol Aup1
Ensembl Gene ENSMUSG00000068328
Gene Nameancient ubiquitous protein 1
Synonyms
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83054521-83057808 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83055024 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 84 (A84V)
Ref Sequence ENSEMBL: ENSMUSP00000090281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000077502] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606] [ENSMUST00000204803]
Predicted Effect probably benign
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077502
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092618
AA Change: A84V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328
AA Change: A84V

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect unknown
Transcript: ENSMUST00000203915
AA Change: A72V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect unknown
Transcript: ENSMUST00000204343
AA Change: A66V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect probably benign
Transcript: ENSMUST00000204803
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The protein encoded by this gene contains several conserved domains including a hydrophobic domain, an acetyltransferase domain, a ubiquitin binding domain, and a domain required for recruitment of ubiquitin-conjugating enzyme E2 G2 (Ube2g2). In humans, this protein localizes to the endoplasmic reticulum and to lipid droplets. This protein is thought to be involved both in the degradation of misfolded proteins from the endoplasmic reticulum and in the storage of neutral lipids. Reduced expression of the human ortholog of this gene strongly reduces lipid droplet clustering in the cell, and causes stabilization of misfolded proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Aup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Aup1 APN 6 83056409 missense probably damaging 1.00
IGL02505:Aup1 APN 6 83055277 missense probably benign 0.06
R0637:Aup1 UTSW 6 83056861 missense probably damaging 1.00
R1544:Aup1 UTSW 6 83055206 missense possibly damaging 0.84
R1686:Aup1 UTSW 6 83055245 missense probably damaging 0.97
R4196:Aup1 UTSW 6 83055230 missense probably damaging 1.00
R4512:Aup1 UTSW 6 83056387 nonsense probably null
R5119:Aup1 UTSW 6 83055134 missense probably damaging 0.96
R6329:Aup1 UTSW 6 83054607 unclassified probably benign
R6837:Aup1 UTSW 6 83057298 missense possibly damaging 0.83
R7122:Aup1 UTSW 6 83055142 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTGACTCGCACCGGTAAGC -3'
(R):5'- GAAATAAGGACCCTGACGCG -3'

Sequencing Primer
(F):5'- CGGTAAGCGCTGCGGAG -3'
(R):5'- ACCCTGACGCGGTGATC -3'
Posted On2016-08-04