Incidental Mutation 'R5387:0610009B22Rik'
List |< first << previous [record 8 of 386652] next >> last >|
ID425348
Institutional Source Beutler Lab
Gene Symbol 0610009B22Rik
Ensembl Gene ENSMUSG00000007777
Gene NameRIKEN cDNA 0610009B22 gene
Synonyms
Accession Numbers
Stock #R5387 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location51685386-51688874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51685974 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 32 (D32E)
Ref Sequence ENSEMBL: ENSMUSP00000007921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007921] [ENSMUST00000109098]
Predicted Effect probably benign
Transcript: ENSMUST00000007921
AA Change: D32E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007921
Gene: ENSMUSG00000007777
AA Change: D32E

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 7.3e-52 PFAM
Pfam:Sybindin 46 137 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109098
AA Change: D32E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104726
Gene: ENSMUSG00000007777
AA Change: D32E

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 1e-50 PFAM
Pfam:Sybindin 46 137 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,259,973 S454T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1109A probably damaging Het
Cd33 G A 7: 43,532,053 Q228* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T probably damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 L66Q probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 unknown Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y213C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Micu1 T C 10: 59,839,773 S69P noncoding transcript Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Naglu A T 11: 101,076,724 Y500F probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Oas1g A G 5: 120,878,348 F211L noncoding transcript Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Papolg A T 11: 23,891,796 *37R noncoding transcript Het
Pbrm1 A G 14: 31,082,610 Y962C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pigz T A 16: 31,942,057 L22Q noncoding transcript Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Prpf38a T A 4: 108,566,983 K15N noncoding transcript Het
Prpf40a T A 2: 53,177,410 *120L noncoding transcript Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 C39* probably null Het
Rspry1 A G 8: 94,638,286 T309A possibly damaging Het
Sec61a2 G T 2: 5,882,545 T189K noncoding transcript Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc25a36 T C 9: 97,080,197 H297R noncoding transcript Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 K61* probably null Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F98L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Homo
Wapal A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 V108A probably null Het
Zfp184 T G 13: 21,949,640 *83E noncoding transcript Het
Zfp36 A C 7: 28,377,868 L217R possibly damaging Het
Other mutations in 0610009B22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:0610009B22Rik APN 11 51685843 missense probably damaging 0.99
R1657:0610009B22Rik UTSW 11 51685678 missense probably benign 0.00
R5157:0610009B22Rik UTSW 11 51686066 missense probably benign
R5541:0610009B22Rik UTSW 11 51685969 missense probably benign 0.02
R5649:0610009B22Rik UTSW 11 51685972 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATGCAGCATGATGAGCC -3'
(R):5'- ATCATTTTAAATCAGTGGGGAGGGG -3'

Sequencing Primer
(F):5'- ATGATGAGCCGCATGTGC -3'
(R):5'- GCCTGTAATACCAGCAGTTATGAGAC -3'
Posted OnAug 04, 2016