Incidental Mutation 'R5387:Naglu'
ID425351
Institutional Source Beutler Lab
Gene Symbol Naglu
Ensembl Gene ENSMUSG00000001751
Gene Namealpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Synonyms
MMRRC Submission 042959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5387 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101070012-101077672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101076724 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 500 (Y500F)
Ref Sequence ENSEMBL: ENSMUSP00000001802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802] [ENSMUST00000019445]
Predicted Effect probably damaging
Transcript: ENSMUST00000001802
AA Change: Y500F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751
AA Change: Y500F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced open field activity, massive accumulation of heparan sulfate in kidney and liver, elevated gangliosides in brain, and presence of vacuoles in macrophages, epithelial cells, and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,685,974 D32E probably benign Het
2210408I21Rik T A 13: 77,259,973 S140T probably benign Het
Ahnak T C 19: 9,003,691 S780P probably damaging Het
Ankhd1 C A 18: 36,634,644 H1205N probably damaging Het
Ano1 T C 7: 144,648,619 K139R probably benign Het
Anp32b T G 4: 46,468,573 C114W probably damaging Het
Ascl1 C T 10: 87,492,689 A134T probably damaging Het
Atl2 C T 17: 79,852,800 E453K probably benign Het
Aup1 C T 6: 83,055,024 A84V probably damaging Het
Btbd7 A T 12: 102,837,785 M332K probably damaging Het
Cacna1d A G 14: 30,100,751 V1107A probably damaging Het
Cd33 G A 7: 43,532,053 Q114* probably null Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Defb22 C A 2: 152,485,906 A120S unknown Het
Dnah7b A G 1: 46,188,659 I1347M probably damaging Het
Efcab5 A G 11: 77,134,842 I549T possibly damaging Het
Esp15 T A 17: 39,644,577 probably null Het
Fbxo7 A G 10: 86,024,654 T42A probably benign Het
Filip1 A G 9: 79,818,274 I1021T probably benign Het
Gad1 C A 2: 70,563,851 S7* probably null Het
Gm281 C A 14: 13,914,438 M1I probably null Het
H2-Q7 C T 17: 35,439,542 T52M probably damaging Het
H2-T3 C T 17: 36,186,702 G28R probably benign Het
Hist1h2ad T A 13: 23,574,667 probably null Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ift81 A G 5: 122,555,535 Y604H probably damaging Het
Igsf11 A G 16: 39,022,423 Y154C probably damaging Het
Kif26b G T 1: 178,914,876 A846S probably benign Het
Lnx2 G A 5: 147,028,154 P420S probably benign Het
Lrit2 A G 14: 37,072,259 T427A probably damaging Het
Lrrc43 G T 5: 123,499,671 probably null Het
Mug1 T C 6: 121,884,394 Y1325H probably damaging Het
Npy4r A G 14: 34,146,983 M116T probably benign Het
Nrd1 A G 4: 109,039,762 Y526C probably damaging Het
Nrp2 T C 1: 62,762,813 S472P probably benign Het
Olfr102 T A 17: 37,314,292 T31S probably benign Het
Olfr361 T C 2: 37,085,719 T10A possibly damaging Het
Otogl T A 10: 107,780,933 T1828S probably benign Het
Pank2 C T 2: 131,274,262 T200I probably benign Het
Pbrm1 A G 14: 31,082,610 Y946C probably damaging Het
Pde12 A T 14: 26,666,453 S437T probably benign Het
Pikfyve A G 1: 65,265,268 K1710E possibly damaging Het
Plcd3 A G 11: 103,078,455 S229P probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Prkaa2 C A 4: 105,040,177 D280Y probably damaging Het
Ptprg T A 14: 12,153,873 S531R probably damaging Het
R3hdm2 T C 10: 127,485,434 S620P probably damaging Het
Rab33b A G 3: 51,493,455 T117A probably damaging Het
Rasal2 T C 1: 157,157,765 D804G possibly damaging Het
Rbp3 A G 14: 33,956,413 T773A possibly damaging Het
Rrnad1 A T 3: 87,930,011 probably benign Het
Rspry1 A G 8: 94,638,286 T185A possibly damaging Het
Sec61a2 G T 2: 5,882,545 probably benign Het
Setx C T 2: 29,147,594 R1364C probably benign Het
Shtn1 G T 19: 59,038,369 L97M probably damaging Het
Slc35f1 T C 10: 53,108,164 L340P probably damaging Het
Slc45a1 T A 4: 150,643,909 probably benign Het
Slmap T C 14: 26,459,933 E386G probably benign Het
Smc2 C T 4: 52,475,096 A924V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Tecta G A 9: 42,375,063 L766F probably damaging Het
Tle3 C T 9: 61,407,489 probably null Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Trem1 T C 17: 48,241,513 I26T possibly damaging Het
Ttc7b G T 12: 100,446,963 Q199K possibly damaging Het
Ubap2l T C 3: 90,006,596 Y975C probably benign Het
Ubxn11 C A 4: 134,123,426 D196E probably damaging Het
Unc80 A G 1: 66,530,021 H945R possibly damaging Het
Usp15 A G 10: 123,131,286 I405T probably damaging Het
Uty C T Y: 1,189,339 E138K probably damaging Het
Wapl A G 14: 34,677,295 E107G probably benign Het
Wbp1l T C 19: 46,644,457 probably null Het
Zfp184 T G 13: 21,949,640 probably benign Het
Zfp36 A C 7: 28,377,868 L205R possibly damaging Het
Other mutations in Naglu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Naglu APN 11 101076952 missense possibly damaging 0.84
IGL01025:Naglu APN 11 101073947 missense probably benign 0.01
IGL01775:Naglu APN 11 101074095 missense probably damaging 1.00
tulane UTSW 11 101070332 missense probably benign 0.01
R0044:Naglu UTSW 11 101071217 missense probably damaging 0.99
R0281:Naglu UTSW 11 101074027 missense probably damaging 0.99
R0395:Naglu UTSW 11 101074107 unclassified probably benign
R1624:Naglu UTSW 11 101076525 missense probably damaging 1.00
R1739:Naglu UTSW 11 101076403 missense possibly damaging 0.88
R2092:Naglu UTSW 11 101076720 missense possibly damaging 0.94
R4118:Naglu UTSW 11 101074082 missense probably benign 0.39
R4582:Naglu UTSW 11 101071929 missense probably damaging 0.97
R4792:Naglu UTSW 11 101071106 missense probably damaging 1.00
R4834:Naglu UTSW 11 101076988 missense probably benign
R5232:Naglu UTSW 11 101070150 missense probably benign 0.02
R6463:Naglu UTSW 11 101077351 unclassified probably null
R6483:Naglu UTSW 11 101071181 missense probably damaging 1.00
R7141:Naglu UTSW 11 101072230 missense probably benign 0.10
R7187:Naglu UTSW 11 101070332 missense probably benign 0.01
R7232:Naglu UTSW 11 101076426 missense probably damaging 1.00
R7478:Naglu UTSW 11 101071899 missense probably damaging 1.00
X0023:Naglu UTSW 11 101072014 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACCATGGCCTGTTTGGAG -3'
(R):5'- ACATCCAGCAGGTCATAGCG -3'

Sequencing Primer
(F):5'- ATGGTCGGCACTGGCATAG -3'
(R):5'- CCAGCAGGTCATAGCGGAAGG -3'
Posted On2016-08-04