Incidental Mutation 'R5389:Net1'
ID425489
Institutional Source Beutler Lab
Gene Symbol Net1
Ensembl Gene ENSMUSG00000021215
Gene Nameneuroepithelial cell transforming gene 1
SynonymsmNET1, 0610025H04Rik, 9530071N24Rik, Net1 homolog
MMRRC Submission 042961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5389 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3882018-3918220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3886170 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 305 (E305K)
Ref Sequence ENSEMBL: ENSMUSP00000097529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091853] [ENSMUST00000099946] [ENSMUST00000222504]
Predicted Effect probably damaging
Transcript: ENSMUST00000091853
AA Change: E359K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215
AA Change: E359K

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099946
AA Change: E305K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097529
Gene: ENSMUSG00000021215
AA Change: E305K

DomainStartEndE-ValueType
RhoGEF 124 301 2.84e-54 SMART
PH 333 449 5.79e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222442
Predicted Effect probably benign
Transcript: ENSMUST00000222504
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed mammary gland development during puberty associated with slower ductal extension, reduced ductal branching and epithelial cell proliferation, disorganized myoepithelial and ductal epithelial cells, and increased collagen deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,638,795 V398A probably benign Het
A430033K04Rik T A 5: 138,646,297 V148E probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Ankrd26 T A 6: 118,508,575 Q1446L possibly damaging Het
Anks6 A T 4: 47,038,900 probably benign Het
Arrb2 T C 11: 70,438,658 S265P probably damaging Het
Baiap2 T C 11: 119,996,670 S264P probably damaging Het
Cadps2 A G 6: 23,329,104 V938A probably damaging Het
Cavin4 G T 4: 48,663,907 V96F probably damaging Het
Cenpe T C 3: 135,259,388 probably null Het
Crocc2 C A 1: 93,215,641 Q1322K probably benign Het
Cryzl2 T A 1: 157,461,976 C61* probably null Het
Dazl T C 17: 50,288,690 I56V probably benign Het
Dnah12 A T 14: 26,735,749 D890V probably damaging Het
Dnah9 C A 11: 66,095,314 E1165* probably null Het
Dnmt3l T A 10: 78,056,831 probably null Het
Elp2 A G 18: 24,606,903 N62S possibly damaging Het
Fam216b T A 14: 78,085,063 H26L possibly damaging Het
Fbxw25 T A 9: 109,652,886 Q244L possibly damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Gm1966 T C 7: 106,598,235 noncoding transcript Het
Gm5724 A G 6: 141,740,467 F216L probably benign Het
Igf2r T C 17: 12,725,416 Y400C probably damaging Het
Iqcc A G 4: 129,618,620 F20L probably benign Het
Klhl5 T A 5: 65,141,282 L135M possibly damaging Het
Klk1b16 A T 7: 44,140,988 M196L possibly damaging Het
Ltf T C 9: 111,029,651 M489T possibly damaging Het
Mctp2 G T 7: 72,214,087 R343S possibly damaging Het
Nbas T A 12: 13,534,577 probably null Het
Ncr1 A T 7: 4,340,933 M177L probably benign Het
Nfx1 T C 4: 40,985,000 F375L probably damaging Het
Notch3 T A 17: 32,139,189 I1687L probably benign Het
Obsl1 A T 1: 75,503,261 probably benign Het
Olfr1000 A G 2: 85,608,283 F209S probably benign Het
Olfr1052 G A 2: 86,298,217 V134M possibly damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Olfr507 A C 7: 108,622,717 I302L probably damaging Het
Olfr620 G T 7: 103,611,590 Y254* probably null Het
Olfr698 A T 7: 106,753,083 F102I probably damaging Het
Orai1 A T 5: 123,029,501 M246L probably benign Het
Pcdhga12 G A 18: 37,766,732 A206T probably damaging Het
Plxdc2 C A 2: 16,650,187 T199K probably damaging Het
Prkd1 T A 12: 50,343,137 I819F probably damaging Het
Ptpn9 T C 9: 57,056,837 probably benign Het
Rabl6 T C 2: 25,588,654 E255G probably damaging Het
Sdccag3 T C 2: 26,385,547 D244G probably damaging Het
Sema3e T C 5: 14,236,085 probably benign Het
Serpina3c T C 12: 104,149,440 M282V possibly damaging Het
Slco2b1 A G 7: 99,685,925 I216T probably damaging Het
Slco6b1 T C 1: 96,988,584 noncoding transcript Het
Slco6d1 A T 1: 98,443,644 I285F probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Sp9 C A 2: 73,274,297 N398K probably damaging Het
Sycp2 A C 2: 178,377,702 probably null Het
Tbc1d23 T C 16: 57,198,928 D219G probably damaging Het
Tdpoz3 A G 3: 93,826,872 R285G probably benign Het
Trim2 T A 3: 84,167,653 Q694L probably null Het
Trim23 T A 13: 104,192,033 V293D probably damaging Het
Ttn A G 2: 76,834,839 probably benign Het
Vmn2r12 T A 5: 109,090,395 Y493F probably benign Het
Vps41 T A 13: 18,862,538 I753N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Yme1l1 G A 2: 23,193,234 G571R probably damaging Het
Zfp322a A T 13: 23,356,979 C198S probably damaging Het
Other mutations in Net1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Net1 APN 13 3893391 utr 5 prime probably benign
IGL02271:Net1 APN 13 3887663 missense probably damaging 1.00
IGL02698:Net1 APN 13 3887569 critical splice donor site probably null
R0580:Net1 UTSW 13 3886612 missense probably damaging 1.00
R1028:Net1 UTSW 13 3884375 missense probably damaging 1.00
R1070:Net1 UTSW 13 3912930 missense probably benign 0.31
R1775:Net1 UTSW 13 3887642 missense probably damaging 1.00
R1834:Net1 UTSW 13 3912941 unclassified probably benign
R3968:Net1 UTSW 13 3907795 critical splice donor site probably null
R4056:Net1 UTSW 13 3884949 missense probably damaging 1.00
R4884:Net1 UTSW 13 3884252 nonsense probably null
R4937:Net1 UTSW 13 3884905 missense probably damaging 1.00
R5068:Net1 UTSW 13 3886740 missense probably benign 0.30
R5123:Net1 UTSW 13 3886623 missense probably damaging 0.97
R5390:Net1 UTSW 13 3893379 missense probably benign 0.18
R5509:Net1 UTSW 13 3884320 missense probably benign 0.00
R6548:Net1 UTSW 13 3886074 intron probably null
R7056:Net1 UTSW 13 3884845 missense probably benign 0.00
R7138:Net1 UTSW 13 3888510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGAAGCAATGGCCTC -3'
(R):5'- AGTGGTACTTTCAAGTCTCGTGC -3'

Sequencing Primer
(F):5'- GAAGCAATGGCCTCCTTCCTG -3'
(R):5'- AGCCTTGAACTAGTTGCCCAGTATG -3'
Posted On2016-08-04