Incidental Mutation 'R5390:Pigo'
ID425507
Institutional Source Beutler Lab
Gene Symbol Pigo
Ensembl Gene ENSMUSG00000028454
Gene Namephosphatidylinositol glycan anchor biosynthesis, class O
Synonyms
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43017635-43025819 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 43019645 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000067481] [ENSMUST00000098109]
Predicted Effect probably null
Transcript: ENSMUST00000067481
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000067481
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098109
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149333
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155429
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Pigo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Pigo APN 4 43021767 missense possibly damaging 0.63
IGL02176:Pigo APN 4 43019352 missense probably benign 0.20
IGL03197:Pigo APN 4 43022103 missense possibly damaging 0.92
R0207:Pigo UTSW 4 43023824 splice site probably benign
R0464:Pigo UTSW 4 43019814 missense probably benign 0.02
R0891:Pigo UTSW 4 43020519 nonsense probably null
R1445:Pigo UTSW 4 43021460 missense probably benign
R1484:Pigo UTSW 4 43024779 missense probably damaging 0.99
R1547:Pigo UTSW 4 43020689 missense probably benign 0.01
R1624:Pigo UTSW 4 43024661 missense probably damaging 1.00
R1847:Pigo UTSW 4 43024710 nonsense probably null
R3110:Pigo UTSW 4 43021083 missense probably benign 0.00
R3111:Pigo UTSW 4 43021083 missense probably benign 0.00
R3112:Pigo UTSW 4 43021083 missense probably benign 0.00
R3824:Pigo UTSW 4 43020909 missense possibly damaging 0.95
R3850:Pigo UTSW 4 43025084 missense probably benign 0.01
R3980:Pigo UTSW 4 43019231 missense probably damaging 1.00
R3982:Pigo UTSW 4 43023482 missense probably benign 0.00
R4520:Pigo UTSW 4 43020301 missense probably benign 0.16
R5033:Pigo UTSW 4 43019412 missense probably null 1.00
R5054:Pigo UTSW 4 43021337 missense probably damaging 1.00
R5240:Pigo UTSW 4 43020675 missense possibly damaging 0.95
R5468:Pigo UTSW 4 43024562 critical splice donor site probably null
R5775:Pigo UTSW 4 43023475 missense probably damaging 1.00
R5839:Pigo UTSW 4 43022104 missense probably damaging 1.00
R5924:Pigo UTSW 4 43023389 nonsense probably null
R6111:Pigo UTSW 4 43019724 missense probably benign 0.18
R6451:Pigo UTSW 4 43021412 missense probably benign
R6533:Pigo UTSW 4 43022697 missense probably benign 0.07
R6884:Pigo UTSW 4 43022627 missense possibly damaging 0.88
R7026:Pigo UTSW 4 43023380 nonsense probably null
Z1088:Pigo UTSW 4 43019409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACATCAAGGGAGGATCTTTG -3'
(R):5'- CAGGCCCTTTTACTGTGCTG -3'

Sequencing Primer
(F):5'- AGGATCTTTGGGCCAAGTCCAC -3'
(R):5'- AGGCAGTCTCAGCTTGGGTC -3'
Posted On2016-08-04