Incidental Mutation 'R5390:Cachd1'
ID425508
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Namecache domain containing 1
SynonymsVwcd1, B430218L07Rik, 1190007F10Rik
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location100776675-101029220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100981006 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 822 (M822K)
Ref Sequence ENSEMBL: ENSMUSP00000095568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030257
AA Change: M822K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: M822K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097955
AA Change: M822K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: M822K

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100966966 missense probably benign 0.05
IGL01531:Cachd1 APN 4 100953034 missense probably benign 0.02
IGL01705:Cachd1 APN 4 100983539 missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100992872 missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100974128 missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100952097 missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100968098 missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100952085 missense probably damaging 0.98
IGL03084:Cachd1 APN 4 101003088 missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100994737 missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100953205 missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100897703 missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100994842 splice site probably benign
R0646:Cachd1 UTSW 4 100988221 missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100974876 missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100983301 splice site probably benign
R1156:Cachd1 UTSW 4 100988619 missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100974840 missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100974917 missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100988598 missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100966972 missense probably benign 0.02
R1774:Cachd1 UTSW 4 100964435 missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100967043 missense probably benign 0.02
R1845:Cachd1 UTSW 4 100777358 missense probably benign 0.01
R1869:Cachd1 UTSW 4 100983390 missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100953169 missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100990844 missense probably damaging 1.00
R2082:Cachd1 UTSW 4 101002958 missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100949069 splice site probably benign
R2517:Cachd1 UTSW 4 100980882 intron probably null
R2896:Cachd1 UTSW 4 100970903 missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100974880 nonsense probably null
R3818:Cachd1 UTSW 4 100990865 missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100970888 missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100953130 nonsense probably null
R4791:Cachd1 UTSW 4 100918085 missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100994738 missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100964491 missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100966200 missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100952122 missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100968085 missense possibly damaging 0.88
R5573:Cachd1 UTSW 4 100974079 missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100865006 missense probably benign 0.31
R5905:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100952019 missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100983556 missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100981031 nonsense probably null
R6367:Cachd1 UTSW 4 101002970 missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100952118 missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100989486 missense probably benign
R6691:Cachd1 UTSW 4 100989486 missense probably benign
R7129:Cachd1 UTSW 4 100918066 missense probably null 0.99
R7187:Cachd1 UTSW 4 100976355 missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100777178 missense unknown
Predicted Primers PCR Primer
(F):5'- CAACTGTTCATGTTAGCACTGG -3'
(R):5'- ACACATCTCCTGTCTCGACG -3'

Sequencing Primer
(F):5'- GCACTGGTCTTGTTCAAAAAGCC -3'
(R):5'- GCGGTCCACACCTAGTACTG -3'
Posted On2016-08-04