Incidental Mutation 'R5390:Glcci1'
ID425511
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Nameglucocorticoid induced transcript 1
SynonymsFam117c, GIG18, Tssn1
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8509600-8597548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8537835 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 151 (Q151L)
Ref Sequence ENSEMBL: ENSMUSP00000069444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162383] [ENSMUST00000162564] [ENSMUST00000162567]
Predicted Effect probably benign
Transcript: ENSMUST00000064285
AA Change: Q151L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: Q151L

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161217
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161494
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162383
SMART Domains Protein: ENSMUSP00000125260
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 94 3.9e-33 PFAM
Predicted Effect silent
Transcript: ENSMUST00000162564
Predicted Effect probably benign
Transcript: ENSMUST00000162567
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8579596 missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8558581 missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8582757 missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8579678 missense probably damaging 1.00
R1084:Glcci1 UTSW 6 8573221 nonsense probably null
R1289:Glcci1 UTSW 6 8593088 missense possibly damaging 0.70
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8591620 missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8537837 missense probably benign 0.06
R1982:Glcci1 UTSW 6 8592980 missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8582590 missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8558566 missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8582601 nonsense probably null
R5166:Glcci1 UTSW 6 8537854 missense probably benign 0.23
R6351:Glcci1 UTSW 6 8573203 nonsense probably null
X0065:Glcci1 UTSW 6 8591636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTTGTGAGGCATGATGAAATG -3'
(R):5'- AACAAGGGATGCTGCTTTGG -3'

Sequencing Primer
(F):5'- CCTAAAATAGTTGGGCTTTCAAGGG -3'
(R):5'- TGGTTGGGTTTATTTCATATTCAGG -3'
Posted On2016-08-04