Incidental Mutation 'R5390:Gpnmb'
ID425512
Institutional Source Beutler Lab
Gene Symbol Gpnmb
Ensembl Gene ENSMUSG00000029816
Gene Nameglycoprotein (transmembrane) nmb
SynonymsOsteoactivin, Dchil
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location49036546-49070929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49047841 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 269 (D269V)
Ref Sequence ENSEMBL: ENSMUSP00000145376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031840] [ENSMUST00000203757] [ENSMUST00000204260]
Predicted Effect probably damaging
Transcript: ENSMUST00000031840
AA Change: D269V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031840
Gene: ENSMUSG00000029816
AA Change: D269V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 500 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203757
Predicted Effect probably damaging
Transcript: ENSMUST00000204260
AA Change: D269V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145376
Gene: ENSMUSG00000029816
AA Change: D269V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
PKD 250 386 4.96e-9 SMART
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204460
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane glycoprotein which shows homology to the pMEL17 precursor, a melanocyte-specific protein. GPNMB shows expression in the lowly metastatic human melanoma cell lines and xenografts but does not show expression in the highly metastatic cell lines. GPNMB may be involved in growth delay and reduction of metastatic potential. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit dispersed pigmentation of the iris, deterioration of the posterior iris epithelium and slit-like transillumination defects. The mutation contributes to glaucoma, especially in combination with the brown coat color mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Gpnmb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Gpnmb APN 6 49055659 missense probably benign 0.01
IGL01291:Gpnmb APN 6 49055681 missense probably benign 0.12
IGL01307:Gpnmb APN 6 49045365 missense probably benign 0.03
IGL01398:Gpnmb APN 6 49050431 missense probably benign 0.02
IGL01531:Gpnmb APN 6 49047458 splice site probably benign
IGL01936:Gpnmb APN 6 49047450 missense probably null 1.00
ANU05:Gpnmb UTSW 6 49055681 missense probably benign 0.12
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0242:Gpnmb UTSW 6 49047342 missense probably damaging 0.99
R0413:Gpnmb UTSW 6 49042803 missense probably benign
R0690:Gpnmb UTSW 6 49048015 missense probably benign 0.24
R0884:Gpnmb UTSW 6 49047913 missense possibly damaging 0.65
R1659:Gpnmb UTSW 6 49047852 missense probably damaging 1.00
R3703:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R3705:Gpnmb UTSW 6 49051865 missense possibly damaging 0.95
R4629:Gpnmb UTSW 6 49051060 missense possibly damaging 0.82
R4782:Gpnmb UTSW 6 49045483 splice site probably null
R4799:Gpnmb UTSW 6 49045483 splice site probably null
R4916:Gpnmb UTSW 6 49051970 missense probably damaging 1.00
R5223:Gpnmb UTSW 6 49056205 missense probably benign 0.01
R5512:Gpnmb UTSW 6 49045464 missense possibly damaging 0.62
R5833:Gpnmb UTSW 6 49044018 missense probably damaging 1.00
R6103:Gpnmb UTSW 6 49042886 missense possibly damaging 0.86
R7211:Gpnmb UTSW 6 49052015 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTTAGTCTTCAGGCAGAGGGC -3'
(R):5'- CACTTAAAGAGGGGCTAGGTGTTG -3'

Sequencing Primer
(F):5'- TTCAGGCAGAGGGCGTCTC -3'
(R):5'- CTAGGTGTTGATAATGTGGGCAGAG -3'
Posted On2016-08-04