Incidental Mutation 'R5390:Anxa4'
ID425513
Institutional Source Beutler Lab
Gene Symbol Anxa4
Ensembl Gene ENSMUSG00000029994
Gene Nameannexin A4
Synonymsannexin IV, Xanx-4, AIV, Anx4
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86736840-86793584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86753883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 104 (T104M)
Ref Sequence ENSEMBL: ENSMUSP00000145421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001187] [ENSMUST00000113675] [ENSMUST00000123732] [ENSMUST00000127152] [ENSMUST00000155456] [ENSMUST00000204398] [ENSMUST00000204441]
Predicted Effect probably damaging
Transcript: ENSMUST00000001187
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001187
Gene: ENSMUSG00000029994
AA Change: T104M

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113675
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109305
Gene: ENSMUSG00000029994
AA Change: T104M

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123732
AA Change: T82M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115346
Gene: ENSMUSG00000029994
AA Change: T82M

DomainStartEndE-ValueType
ANX 31 79 1.6e-13 SMART
ANX 81 133 6.69e-25 SMART
ANX 165 217 9.84e-23 SMART
Pfam:Annexin 227 254 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127152
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138194
Gene: ENSMUSG00000029994
AA Change: T104M

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129772
Predicted Effect probably benign
Transcript: ENSMUST00000155456
SMART Domains Protein: ENSMUSP00000117378
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 22 69 1.06e-2 SMART
ANX 83 135 9.84e-23 SMART
ANX 158 210 2.37e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204398
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144961
Gene: ENSMUSG00000029994
AA Change: T104M

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204441
AA Change: T104M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994
AA Change: T104M

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele often display abnormal maternal nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Anxa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Anxa4 APN 6 86752205 missense probably damaging 1.00
IGL02601:Anxa4 APN 6 86760701 missense probably benign 0.00
R0423:Anxa4 UTSW 6 86760737 missense probably damaging 1.00
R0948:Anxa4 UTSW 6 86741931 missense probably damaging 1.00
R1846:Anxa4 UTSW 6 86741911 unclassified probably null
R2341:Anxa4 UTSW 6 86743153 missense probably benign 0.38
R4058:Anxa4 UTSW 6 86757818 critical splice donor site probably null
R5000:Anxa4 UTSW 6 86765784 utr 5 prime probably benign
R6503:Anxa4 UTSW 6 86744667 missense probably damaging 1.00
R6897:Anxa4 UTSW 6 86743178 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGATATGGCAGAACACTCACG -3'
(R):5'- CAGGCCATGTTTCTAGACCC -3'

Sequencing Primer
(F):5'- TTTCAAGTCCTGGGCAAC -3'
(R):5'- GACCCTGTGAGCTGCTATTATAATC -3'
Posted On2016-08-04