Incidental Mutation 'R5390:Ddx19a'
ID425522
Institutional Source Beutler Lab
Gene Symbol Ddx19a
Ensembl Gene ENSMUSG00000015023
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
SynonymsEif4a-rs1, Ddx19, DBP5
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110974996-110997800 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 110980631 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 176 (Q176*)
Ref Sequence ENSEMBL: ENSMUSP00000047898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040416]
Predicted Effect probably null
Transcript: ENSMUST00000040416
AA Change: Q176*
SMART Domains Protein: ENSMUSP00000047898
Gene: ENSMUSG00000015023
AA Change: Q176*

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
DEXDc 110 309 8.58e-44 SMART
HELICc 346 433 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173183
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Ddx19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ddx19a APN 8 110976470 missense probably benign
IGL01395:Ddx19a APN 8 110990532 splice site probably benign
IGL01676:Ddx19a APN 8 110980989 critical splice donor site probably null
IGL02243:Ddx19a APN 8 110976456 missense probably benign 0.06
IGL02677:Ddx19a APN 8 110989609 missense probably benign 0.24
IGL02870:Ddx19a APN 8 110983626 missense probably damaging 1.00
R0416:Ddx19a UTSW 8 110979057 missense probably damaging 0.96
R1574:Ddx19a UTSW 8 110993111 splice site probably benign
R1664:Ddx19a UTSW 8 110989498 missense probably damaging 0.99
R4470:Ddx19a UTSW 8 110976479 missense probably benign 0.00
R4552:Ddx19a UTSW 8 110978566 nonsense probably null
R4668:Ddx19a UTSW 8 110979084 missense probably damaging 1.00
R4847:Ddx19a UTSW 8 110977045 missense probably damaging 1.00
R5815:Ddx19a UTSW 8 110979149 nonsense probably null
R6842:Ddx19a UTSW 8 110978625 missense possibly damaging 0.69
R7045:Ddx19a UTSW 8 110993074 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGTTTACAACACACAAGCCCATG -3'
(R):5'- TACTGAACCACTGATGCCGG -3'

Sequencing Primer
(F):5'- GACACACAGTCTCTGAAATTTAAGC -3'
(R):5'- ATGCCGGGTCCCTTACTGATG -3'
Posted On2016-08-04