Incidental Mutation 'R5390:Zfp653'
ID425523
Institutional Source Beutler Lab
Gene Symbol Zfp653
Ensembl Gene ENSMUSG00000038895
Gene Namezinc finger protein 653
Synonyms
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22055411-22071376 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 22057803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000179605]
Predicted Effect probably null
Transcript: ENSMUST00000043922
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179605
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216916
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Other mutations in Zfp653
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02541:Zfp653 APN 9 22055783 missense probably damaging 1.00
PIT4403001:Zfp653 UTSW 9 22065757 missense probably damaging 0.96
R1245:Zfp653 UTSW 9 22056422 missense probably damaging 1.00
R1473:Zfp653 UTSW 9 22058220 missense possibly damaging 0.92
R1564:Zfp653 UTSW 9 22055859 missense probably damaging 1.00
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R1574:Zfp653 UTSW 9 22057978 nonsense probably null
R2851:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2852:Zfp653 UTSW 9 22057566 missense probably benign 0.09
R2967:Zfp653 UTSW 9 22065730 missense probably damaging 1.00
R4937:Zfp653 UTSW 9 22055778 missense probably damaging 1.00
R6135:Zfp653 UTSW 9 22058262 missense probably damaging 0.97
R6798:Zfp653 UTSW 9 22057372 missense probably damaging 1.00
R7146:Zfp653 UTSW 9 22065899 missense probably damaging 1.00
R7258:Zfp653 UTSW 9 22065820 missense probably benign 0.07
R7486:Zfp653 UTSW 9 22056528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACATTTCACTGCTGTC -3'
(R):5'- CATCCGCCTCAATGTAGCTG -3'

Sequencing Primer
(F):5'- TGCATTCTCAGGCACCGTG -3'
(R):5'- CCTCAATGTAGCTGCTGGC -3'
Posted On2016-08-04