Incidental Mutation 'R5390:Net1'
ID425535
Institutional Source Beutler Lab
Gene Symbol Net1
Ensembl Gene ENSMUSG00000021215
Gene Nameneuroepithelial cell transforming gene 1
SynonymsmNET1, 0610025H04Rik, 9530071N24Rik, Net1 homolog
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location3882018-3918220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3893379 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 3 (A3T)
Ref Sequence ENSEMBL: ENSMUSP00000152173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091853] [ENSMUST00000099946] [ENSMUST00000222504]
Predicted Effect probably benign
Transcript: ENSMUST00000091853
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099946
AA Change: A3T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097529
Gene: ENSMUSG00000021215
AA Change: A3T

DomainStartEndE-ValueType
RhoGEF 124 301 2.84e-54 SMART
PH 333 449 5.79e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222017
Predicted Effect probably benign
Transcript: ENSMUST00000222504
AA Change: A3T

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed mammary gland development during puberty associated with slower ductal extension, reduced ductal branching and epithelial cell proliferation, disorganized myoepithelial and ductal epithelial cells, and increased collagen deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Net1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Net1 APN 13 3893391 utr 5 prime probably benign
IGL02271:Net1 APN 13 3887663 missense probably damaging 1.00
IGL02698:Net1 APN 13 3887569 critical splice donor site probably null
R0580:Net1 UTSW 13 3886612 missense probably damaging 1.00
R1028:Net1 UTSW 13 3884375 missense probably damaging 1.00
R1070:Net1 UTSW 13 3912930 missense probably benign 0.31
R1775:Net1 UTSW 13 3887642 missense probably damaging 1.00
R1834:Net1 UTSW 13 3912941 unclassified probably benign
R3968:Net1 UTSW 13 3907795 critical splice donor site probably null
R4056:Net1 UTSW 13 3884949 missense probably damaging 1.00
R4884:Net1 UTSW 13 3884252 nonsense probably null
R4937:Net1 UTSW 13 3884905 missense probably damaging 1.00
R5068:Net1 UTSW 13 3886740 missense probably benign 0.30
R5123:Net1 UTSW 13 3886623 missense probably damaging 0.97
R5389:Net1 UTSW 13 3886170 missense probably damaging 1.00
R5509:Net1 UTSW 13 3884320 missense probably benign 0.00
R6548:Net1 UTSW 13 3886074 intron probably null
R7056:Net1 UTSW 13 3884845 missense probably benign 0.00
R7138:Net1 UTSW 13 3888510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTTAAACACATTTCAGCCTTGC -3'
(R):5'- AGTTATCGGGAGTCACGTGG -3'

Sequencing Primer
(F):5'- CAGCCTTGCTTATAATAGTTGCAC -3'
(R):5'- ACTCCTGAGCTCTGCGTG -3'
Posted On2016-08-04