Incidental Mutation 'R5390:Grm4'
ID425540
Institutional Source Beutler Lab
Gene Symbol Grm4
Ensembl Gene ENSMUSG00000063239
Gene Nameglutamate receptor, metabotropic 4
SynonymsmGluR4, Gprc1d
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27422387-27521403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27434738 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 491 (C491Y)
Ref Sequence ENSEMBL: ENSMUSP00000156277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118161] [ENSMUST00000118489] [ENSMUST00000231290] [ENSMUST00000231416] [ENSMUST00000231809] [ENSMUST00000232243]
Predicted Effect probably damaging
Transcript: ENSMUST00000118161
AA Change: C746Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113819
Gene: ENSMUSG00000063239
AA Change: C746Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 1.4e-110 PFAM
Pfam:Peripla_BP_6 144 486 9e-13 PFAM
Pfam:NCD3G 516 566 2.4e-14 PFAM
Pfam:7tm_3 599 844 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118489
AA Change: C746Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112578
Gene: ENSMUSG00000063239
AA Change: C746Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ANF_receptor 77 482 6.2e-104 PFAM
Pfam:Peripla_BP_6 144 486 8.3e-12 PFAM
Pfam:NCD3G 516 566 5.4e-15 PFAM
Pfam:7tm_3 597 817 1.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231290
AA Change: C746Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231416
AA Change: C491Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231804
Predicted Effect probably damaging
Transcript: ENSMUST00000231809
AA Change: C699Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000232243
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of theis gene results in impaired motor learning, and reduced paired-pulse facilitation and post-tetanic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Grm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Grm4 APN 17 27434737 nonsense probably null
IGL02380:Grm4 APN 17 27434661 missense probably damaging 1.00
IGL03244:Grm4 APN 17 27434823 missense probably damaging 0.99
R0013:Grm4 UTSW 17 27431575 missense probably benign 0.01
R0352:Grm4 UTSW 17 27451891 splice site probably benign
R0599:Grm4 UTSW 17 27431490 missense probably benign 0.39
R0616:Grm4 UTSW 17 27434564 missense probably damaging 1.00
R0645:Grm4 UTSW 17 27435209 missense probably damaging 1.00
R0726:Grm4 UTSW 17 27438438 splice site probably benign
R1085:Grm4 UTSW 17 27473033 missense probably damaging 1.00
R1486:Grm4 UTSW 17 27434717 missense probably damaging 1.00
R1535:Grm4 UTSW 17 27434801 missense probably benign 0.01
R1799:Grm4 UTSW 17 27472940 missense probably damaging 0.99
R1914:Grm4 UTSW 17 27434712 missense probably damaging 0.99
R2472:Grm4 UTSW 17 27434675 missense probably damaging 1.00
R3759:Grm4 UTSW 17 27435299 missense probably benign 0.00
R4244:Grm4 UTSW 17 27502735 missense probably damaging 1.00
R5476:Grm4 UTSW 17 27434798 missense probably benign 0.04
R5516:Grm4 UTSW 17 27438411 missense probably benign 0.06
R5897:Grm4 UTSW 17 27435163 missense probably benign 0.02
R5956:Grm4 UTSW 17 27435155 missense probably benign 0.01
R6391:Grm4 UTSW 17 27435320 missense probably benign 0.00
R7330:Grm4 UTSW 17 27434824 nonsense probably null
R7449:Grm4 UTSW 17 27435371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAAAGAAAGCAGCTACAGGC -3'
(R):5'- ATCTTTGAGCAGGGCAAGCG -3'

Sequencing Primer
(F):5'- ACACGGCCATGTTCCCTGAC -3'
(R):5'- GGCAAGCGGTCGGTCAG -3'
Posted On2016-08-04