Incidental Mutation 'R5390:Pcyox1l'
ID425543
Institutional Source Beutler Lab
Gene Symbol Pcyox1l
Ensembl Gene ENSMUSG00000024579
Gene Nameprenylcysteine oxidase 1 like
Synonyms
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61696837-61707635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61699362 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 205 (I205V)
Ref Sequence ENSEMBL: ENSMUSP00000025472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025472] [ENSMUST00000195229]
Predicted Effect probably benign
Transcript: ENSMUST00000025472
AA Change: I205V

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025472
Gene: ENSMUSG00000024579
AA Change: I205V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAD_binding_8 31 98 2.8e-12 PFAM
Pfam:Amino_oxidase 36 380 3.5e-11 PFAM
Pfam:Prenylcys_lyase 120 491 1.3e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154763
Predicted Effect probably benign
Transcript: ENSMUST00000195229
SMART Domains Protein: ENSMUSP00000142249
Gene: ENSMUSG00000024579

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DAO 28 108 2.7e-6 PFAM
Pfam:NAD_binding_8 31 99 2e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Pcyox1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Pcyox1l APN 18 61697542 missense probably benign 0.01
IGL02036:Pcyox1l APN 18 61707536 unclassified probably benign
IGL02478:Pcyox1l APN 18 61697709 missense probably benign 0.34
R0036:Pcyox1l UTSW 18 61697421 missense probably benign 0.13
R0325:Pcyox1l UTSW 18 61697893 missense possibly damaging 0.90
R1726:Pcyox1l UTSW 18 61697778 missense probably benign 0.38
R4457:Pcyox1l UTSW 18 61697868 missense probably benign 0.01
R4763:Pcyox1l UTSW 18 61697779 missense probably benign 0.38
R4811:Pcyox1l UTSW 18 61697535 missense possibly damaging 0.67
R4876:Pcyox1l UTSW 18 61699494 missense probably damaging 0.96
R4983:Pcyox1l UTSW 18 61699397 missense probably damaging 0.98
R5813:Pcyox1l UTSW 18 61699288 splice site probably null
R5933:Pcyox1l UTSW 18 61698473 missense probably benign 0.05
R7018:Pcyox1l UTSW 18 61707554 unclassified probably benign
R7356:Pcyox1l UTSW 18 61707550 missense probably null
R7384:Pcyox1l UTSW 18 61698390 missense probably damaging 1.00
R7393:Pcyox1l UTSW 18 61697641 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GAAGGCCATGGTAGTAAGCC -3'
(R):5'- GTGTTCAGAGACATCACCAGC -3'

Sequencing Primer
(F):5'- TAAGCCACAGGGTCTTCATG -3'
(R):5'- TGAAAGCCTGTCTGCACAAGATTC -3'
Posted On2016-08-04