Incidental Mutation 'R5390:Ms4a4d'
ID425545
Institutional Source Beutler Lab
Gene Symbol Ms4a4d
Ensembl Gene ENSMUSG00000024678
Gene Namemembrane-spanning 4-domains, subfamily A, member 4D
Synonyms
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11536801-11558467 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 11548640 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025581]
Predicted Effect probably null
Transcript: ENSMUST00000025581
SMART Domains Protein: ENSMUSP00000025581
Gene: ENSMUSG00000024678

DomainStartEndE-ValueType
Pfam:CD20 43 141 1.5e-18 PFAM
transmembrane domain 146 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr1437 T A 19: 12,322,141 I229F probably damaging Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Ms4a4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Ms4a4d APN 19 11557971 missense probably damaging 0.99
IGL00951:Ms4a4d APN 19 11554921 missense probably benign 0.00
IGL02627:Ms4a4d APN 19 11548623 missense probably damaging 1.00
IGL02806:Ms4a4d APN 19 11556246 missense possibly damaging 0.65
IGL02868:Ms4a4d APN 19 11550282 missense probably damaging 1.00
R0010:Ms4a4d UTSW 19 11554826 missense probably damaging 1.00
R1134:Ms4a4d UTSW 19 11557934 missense possibly damaging 0.49
R4932:Ms4a4d UTSW 19 11557932 missense probably benign 0.05
R5169:Ms4a4d UTSW 19 11557976 missense possibly damaging 0.80
R6581:Ms4a4d UTSW 19 11554840 missense probably damaging 0.99
R7014:Ms4a4d UTSW 19 11548583 missense probably benign 0.17
R7429:Ms4a4d UTSW 19 11557933 missense probably benign 0.38
R7430:Ms4a4d UTSW 19 11557933 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CCAGAACTTCATCCACAATTTCATTCG -3'
(R):5'- GCTATTAACACTGGGATGTGATG -3'

Sequencing Primer
(F):5'- CATCCACAATTTCATTCGTATTTCAG -3'
(R):5'- GGTCTTGCGAAGATCATATGCCC -3'
Posted On2016-08-04