Incidental Mutation 'R5390:Olfr1437'
ID425546
Institutional Source Beutler Lab
Gene Symbol Olfr1437
Ensembl Gene ENSMUSG00000096436
Gene Nameolfactory receptor 1437
SynonymsGA_x6K02T2RE5P-2658227-2657289, MOR214-6
MMRRC Submission 042962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5390 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12319207-12325101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12322141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 229 (I229F)
Ref Sequence ENSEMBL: ENSMUSP00000146333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052558] [ENSMUST00000207241]
Predicted Effect probably damaging
Transcript: ENSMUST00000052558
AA Change: I229F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056003
Gene: ENSMUSG00000096436
AA Change: I229F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 6.7e-55 PFAM
Pfam:7tm_1 42 291 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207241
AA Change: I229F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830454E08Rik T C 9: 120,577,706 probably benign Het
Anxa4 G A 6: 86,753,883 T104M probably damaging Het
BC048562 G T 9: 108,436,578 W9L probably damaging Het
Cachd1 T A 4: 100,981,006 M822K probably damaging Het
Clec4g C A 8: 3,718,441 V97L probably benign Het
Ddx19a G A 8: 110,980,631 Q176* probably null Het
Eml6 T C 11: 29,760,096 H1413R probably damaging Het
Fam161b C T 12: 84,348,634 V512M probably damaging Het
Glcci1 A T 6: 8,537,835 Q151L probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gpnmb A T 6: 49,047,841 D269V probably damaging Het
Gpx3 A T 11: 54,909,549 D191V probably damaging Het
Grm4 C T 17: 27,434,738 C491Y probably damaging Het
H2-M10.4 T A 17: 36,460,641 H215L probably damaging Het
Hrc T A 7: 45,335,485 L20Q probably damaging Het
Hsd17b6 T A 10: 127,991,439 M255L probably benign Het
Hydin A T 8: 110,595,467 I4584L probably benign Het
Ints5 T A 19: 8,896,567 I630K possibly damaging Het
Kctd10 A G 5: 114,365,703 I296T possibly damaging Het
Ltv1 G A 10: 13,182,359 R234C probably damaging Het
Macf1 A G 4: 123,471,753 S1507P probably damaging Het
Megf8 G A 7: 25,340,289 G936D possibly damaging Het
Ms4a4d T C 19: 11,548,640 probably null Het
Net1 C T 13: 3,893,379 A3T probably benign Het
Nlrp2 T C 7: 5,300,909 M206V probably benign Het
Olfr3 C T 2: 36,812,432 R220H probably benign Het
Pcyox1l T C 18: 61,699,362 I205V probably benign Het
Pigo A G 4: 43,019,645 probably null Het
Pla2g6 A T 15: 79,289,693 S590T possibly damaging Het
Pwp2 T C 10: 78,177,771 T539A possibly damaging Het
Rag1 T C 2: 101,642,734 T688A probably benign Het
Senp7 A G 16: 56,169,916 T676A probably benign Het
Slc26a6 T C 9: 108,861,300 probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Sorbs2 A G 8: 45,819,741 H653R probably damaging Het
Stk3 T A 15: 35,114,560 K67* probably null Het
Tctn2 A ACC 5: 124,624,335 probably benign Homo
Ttc30a2 A T 2: 75,977,286 L294Q probably damaging Het
Ttn T C 2: 76,710,051 Y34197C probably damaging Het
Ufc1 A C 1: 171,290,173 L56R probably damaging Het
Usp34 T A 11: 23,444,202 probably null Het
Vnn3 T A 10: 23,851,585 M1K probably null Het
Zfp653 C A 9: 22,057,803 probably null Het
Other mutations in Olfr1437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03034:Olfr1437 APN 19 12322654 missense possibly damaging 0.79
R0319:Olfr1437 UTSW 19 12322316 nonsense probably null
R1603:Olfr1437 UTSW 19 12321984 missense probably damaging 0.99
R2175:Olfr1437 UTSW 19 12322521 missense probably damaging 0.97
R2907:Olfr1437 UTSW 19 12322668 missense probably damaging 1.00
R5250:Olfr1437 UTSW 19 12322066 missense probably benign 0.01
R6949:Olfr1437 UTSW 19 12322428 missense probably damaging 1.00
R7437:Olfr1437 UTSW 19 12322108 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCTCAGACTATAAACCAAAGGG -3'
(R):5'- ATCTCAGGTGTGTGCCTTGC -3'

Sequencing Primer
(F):5'- GTTCAACATAGGAATCAACACAGTG -3'
(R):5'- ACTTCTGTGGACCTAACGTCATCAG -3'
Posted On2016-08-04