Incidental Mutation 'R5377:Pign'
ID425592
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105657812 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 4 (F4Y)
Ref Sequence ENSEMBL: ENSMUSP00000140020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
Predicted Effect probably benign
Transcript: ENSMUST00000070699
AA Change: F4Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: F4Y

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185983
Predicted Effect probably benign
Transcript: ENSMUST00000186485
AA Change: F4Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: F4Y

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187537
AA Change: F4Y

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: F4Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187909
Predicted Effect probably benign
Transcript: ENSMUST00000190811
AA Change: F4Y

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: F4Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3718:Pign UTSW 1 105649281 critical splice donor site probably null
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATAAAGAGTATCTGCTCTCAGGC -3'
(R):5'- GATTTCCTGTGAATGAGCCTAAC -3'

Sequencing Primer
(F):5'- GAGTATCTGCTCTCAGGCCATCAG -3'
(R):5'- GAGCCTAACTAATTTTTCAGTGCC -3'
Posted On2016-08-04