Incidental Mutation 'R5377:Olfr1230'
ID425599
Institutional Source Beutler Lab
Gene Symbol Olfr1230
Ensembl Gene ENSMUSG00000075094
Gene Nameolfactory receptor 1230
SynonymsGA_x6K02T2Q125-50741934-50741017, MOR237-1
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89296351-89297268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89297162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 36 (T36K)
Ref Sequence ENSEMBL: ENSMUSP00000097375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099787
AA Change: T36K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: T36K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-44 PFAM
Pfam:7tm_1 39 285 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Olfr1230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr1230 APN 2 89296455 missense probably benign 0.40
IGL01419:Olfr1230 APN 2 89296345 unclassified probably benign
IGL01644:Olfr1230 APN 2 89296632 missense probably benign 0.01
IGL01653:Olfr1230 APN 2 89297127 missense probably benign 0.08
IGL01674:Olfr1230 APN 2 89296670 missense probably damaging 1.00
IGL02124:Olfr1230 APN 2 89297063 missense probably benign 0.01
IGL03053:Olfr1230 APN 2 89296445 missense probably damaging 0.97
R0504:Olfr1230 UTSW 2 89296739 missense probably damaging 0.99
R1473:Olfr1230 UTSW 2 89296906 nonsense probably null
R1742:Olfr1230 UTSW 2 89296424 missense probably damaging 1.00
R1899:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1900:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1945:Olfr1230 UTSW 2 89296784 missense probably damaging 1.00
R2935:Olfr1230 UTSW 2 89297260 missense possibly damaging 0.69
R3421:Olfr1230 UTSW 2 89296553 missense probably benign 0.03
R5185:Olfr1230 UTSW 2 89296387 missense probably benign
R5400:Olfr1230 UTSW 2 89296913 missense probably damaging 1.00
R6083:Olfr1230 UTSW 2 89297024 missense probably damaging 1.00
R6086:Olfr1230 UTSW 2 89296854 missense probably damaging 1.00
R6155:Olfr1230 UTSW 2 89296421 missense probably damaging 1.00
R6218:Olfr1230 UTSW 2 89296962 missense probably damaging 0.98
R6361:Olfr1230 UTSW 2 89296646 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTGGGTCATGCAGCCTTC -3'
(R):5'- CAGCATGCAGCAATGTCTATTACATAC -3'

Sequencing Primer
(F):5'- CATGCAGCCTTCTAGGGAGATG -3'
(R):5'- CCAGCTCACATCAAATGGA -3'
Posted On2016-08-04