Incidental Mutation 'R5377:Trpm7'
ID425600
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 126842855 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028843
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103224
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGTCACTAGCAACTATAACCC -3'
(R):5'- ACCTTGCTTGGGTCTACCTG -3'

Sequencing Primer
(F):5'- TCATCAGATTTGGTGGCAAGCAC -3'
(R):5'- GTGTTTCATGTTCATCCTACAGAG -3'
Posted On2016-08-04