Incidental Mutation 'R5377:Cecr2'
ID425608
Institutional Source Beutler Lab
Gene Symbol Cecr2
Ensembl Gene ENSMUSG00000071226
Gene NameCECR2, histone acetyl-lysine reader
SynonymsGtl4, 2610101O16Rik, 2810409N01Rik
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120666369-120771190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120756569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 506 (N506D)
Ref Sequence ENSEMBL: ENSMUSP00000108306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100993
AA Change: N506D

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: N506D

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:WHIM3 244 284 5.2e-11 PFAM
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 781 796 N/A INTRINSIC
low complexity region 839 855 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
low complexity region 1202 1223 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112686
AA Change: N506D

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: N506D

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 862 879 N/A INTRINSIC
low complexity region 1145 1159 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124634
Predicted Effect probably benign
Transcript: ENSMUST00000129803
SMART Domains Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
coiled coil region 90 150 N/A INTRINSIC
Pfam:Bromodomain 191 234 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143563
SMART Domains Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 114 131 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Cecr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cecr2 APN 6 120756717 missense probably damaging 1.00
IGL00782:Cecr2 APN 6 120761621 missense probably benign 0.00
IGL01137:Cecr2 APN 6 120762028 missense probably damaging 1.00
IGL01446:Cecr2 APN 6 120758599 missense probably benign
IGL02108:Cecr2 APN 6 120762558 critical splice donor site probably null
IGL02195:Cecr2 APN 6 120731406 missense probably damaging 1.00
IGL02689:Cecr2 APN 6 120762167 missense probably damaging 1.00
IGL03189:Cecr2 APN 6 120762430 missense probably benign 0.13
PIT1430001:Cecr2 UTSW 6 120758479 missense probably benign 0.01
R0200:Cecr2 UTSW 6 120761797 missense probably damaging 1.00
R0586:Cecr2 UTSW 6 120757884 missense probably damaging 1.00
R0715:Cecr2 UTSW 6 120758198 missense probably benign 0.21
R0784:Cecr2 UTSW 6 120758149 missense possibly damaging 0.74
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1343:Cecr2 UTSW 6 120754711 missense probably damaging 0.99
R1349:Cecr2 UTSW 6 120757603 missense probably damaging 0.99
R1386:Cecr2 UTSW 6 120762131 missense probably damaging 1.00
R1438:Cecr2 UTSW 6 120761472 nonsense probably null
R1602:Cecr2 UTSW 6 120755587 missense possibly damaging 0.52
R1664:Cecr2 UTSW 6 120762026 missense probably damaging 0.96
R1731:Cecr2 UTSW 6 120758180 missense possibly damaging 0.74
R1817:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1818:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1819:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1862:Cecr2 UTSW 6 120757941 missense probably damaging 1.00
R1907:Cecr2 UTSW 6 120761160 missense probably benign 0.03
R1911:Cecr2 UTSW 6 120762565 unclassified probably benign
R2135:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
R2273:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R2275:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R3713:Cecr2 UTSW 6 120758260 missense probably damaging 1.00
R4271:Cecr2 UTSW 6 120762475 missense probably damaging 1.00
R4706:Cecr2 UTSW 6 120755578 missense possibly damaging 0.73
R4873:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R4875:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R5137:Cecr2 UTSW 6 120755517 missense probably benign
R5153:Cecr2 UTSW 6 120734560 missense probably benign 0.03
R5598:Cecr2 UTSW 6 120731446 splice site probably null
R5651:Cecr2 UTSW 6 120755560 missense probably damaging 0.96
R5680:Cecr2 UTSW 6 120761426 missense probably benign
R5813:Cecr2 UTSW 6 120762208 missense probably damaging 0.99
R5970:Cecr2 UTSW 6 120720907 missense probably damaging 0.98
R6255:Cecr2 UTSW 6 120758050 missense probably damaging 1.00
R6266:Cecr2 UTSW 6 120761686 missense probably benign
R6630:Cecr2 UTSW 6 120762178 missense probably damaging 1.00
R6737:Cecr2 UTSW 6 120737123 missense possibly damaging 0.86
R6754:Cecr2 UTSW 6 120757578 missense probably damaging 0.98
R6807:Cecr2 UTSW 6 120734542 intron probably null
R7187:Cecr2 UTSW 6 120756686 missense probably benign
R7256:Cecr2 UTSW 6 120762529 missense probably benign
R7282:Cecr2 UTSW 6 120761621 missense
X0012:Cecr2 UTSW 6 120733774 missense probably damaging 0.99
X0063:Cecr2 UTSW 6 120762071 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCACAGCCATAAAGCCTTG -3'
(R):5'- TACTCTGATCGTCCCCTGAG -3'

Sequencing Primer
(F):5'- GCCTTGAGCAGAATACTTATAGAAAC -3'
(R):5'- CCGGGGGCAATGATTTTCC -3'
Posted On2016-08-04