Incidental Mutation 'R5377:Zfp82'
ID425611
Institutional Source Beutler Lab
Gene Symbol Zfp82
Ensembl Gene ENSMUSG00000098022
Gene Namezinc finger protein 82
SynonymsKRAB16
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30054489-30072900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30057166 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 164 (K164E)
Ref Sequence ENSEMBL: ENSMUSP00000138217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080834] [ENSMUST00000182546] [ENSMUST00000182746] [ENSMUST00000182919] [ENSMUST00000183115] [ENSMUST00000183190]
Predicted Effect probably damaging
Transcript: ENSMUST00000080834
AA Change: K194E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079647
Gene: ENSMUSG00000098022
AA Change: K194E

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
ZnF_C2H2 168 190 1.1e-2 SMART
ZnF_C2H2 196 218 1.69e-3 SMART
ZnF_C2H2 224 246 1.79e-2 SMART
ZnF_C2H2 252 274 4.24e-4 SMART
ZnF_C2H2 280 300 5.2e0 SMART
ZnF_C2H2 308 330 7.05e-1 SMART
ZnF_C2H2 336 358 1.2e-3 SMART
ZnF_C2H2 364 386 3.63e-3 SMART
ZnF_C2H2 392 414 4.47e-3 SMART
ZnF_C2H2 420 442 1.79e-2 SMART
ZnF_C2H2 448 470 5.5e-3 SMART
ZnF_C2H2 476 498 5.9e-3 SMART
ZnF_C2H2 504 526 1.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182483
Predicted Effect probably damaging
Transcript: ENSMUST00000182546
AA Change: K164E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138217
Gene: ENSMUSG00000098022
AA Change: K164E

DomainStartEndE-ValueType
KRAB 6 62 5.01e-15 SMART
ZnF_C2H2 138 160 1.1e-2 SMART
ZnF_C2H2 166 188 1.69e-3 SMART
ZnF_C2H2 194 216 1.79e-2 SMART
ZnF_C2H2 222 244 4.24e-4 SMART
ZnF_C2H2 250 270 5.2e0 SMART
ZnF_C2H2 278 300 7.05e-1 SMART
ZnF_C2H2 306 328 1.2e-3 SMART
ZnF_C2H2 334 356 3.63e-3 SMART
ZnF_C2H2 362 384 4.47e-3 SMART
ZnF_C2H2 390 412 1.79e-2 SMART
ZnF_C2H2 418 440 5.5e-3 SMART
ZnF_C2H2 446 468 5.9e-3 SMART
ZnF_C2H2 474 496 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182746
SMART Domains Protein: ENSMUSP00000138567
Gene: ENSMUSG00000058447

DomainStartEndE-ValueType
KRAB 6 56 1.44e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183025
Predicted Effect probably benign
Transcript: ENSMUST00000183115
Predicted Effect probably benign
Transcript: ENSMUST00000183190
SMART Domains Protein: ENSMUSP00000138469
Gene: ENSMUSG00000098022

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Other mutations in Zfp82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Zfp82 APN 7 30066330 missense probably damaging 1.00
IGL03030:Zfp82 APN 7 30057465 missense probably benign 0.00
PIT4142001:Zfp82 UTSW 7 30057276 missense probably damaging 1.00
R0432:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0513:Zfp82 UTSW 7 30056840 missense probably damaging 1.00
R0659:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0959:Zfp82 UTSW 7 30056451 missense probably damaging 1.00
R1510:Zfp82 UTSW 7 30056622 missense probably damaging 1.00
R1697:Zfp82 UTSW 7 30057354 missense probably benign
R2198:Zfp82 UTSW 7 30057511 missense probably benign
R2892:Zfp82 UTSW 7 30056439 missense probably damaging 1.00
R4274:Zfp82 UTSW 7 30056367 missense probably damaging 0.99
R4932:Zfp82 UTSW 7 30056887 unclassified probably null
R5677:Zfp82 UTSW 7 30057124 missense probably benign 0.43
R6822:Zfp82 UTSW 7 30056287 missense probably damaging 1.00
R7146:Zfp82 UTSW 7 30056167 missense probably benign
R7163:Zfp82 UTSW 7 30062244 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTCTGATGGCGAGTGAG -3'
(R):5'- ATCTCAGTCAAGTGAGGCAC -3'

Sequencing Primer
(F):5'- CCCAGTATGGATCCTCTGATGGAG -3'
(R):5'- GGCACACATCTGAAAGAGTGTCC -3'
Posted On2016-08-04