Incidental Mutation 'R5377:Cyp4f40'
ID425651
Institutional Source Beutler Lab
Gene Symbol Cyp4f40
Ensembl Gene ENSMUSG00000090700
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 40
SynonymsEG631304
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32659410-32676687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32675616 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 413 (I413F)
Ref Sequence ENSEMBL: ENSMUSP00000129536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165061]
Predicted Effect probably null
Transcript: ENSMUST00000165061
AA Change: I413F

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129536
Gene: ENSMUSG00000090700
AA Change: I413F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 52 515 2.2e-130 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Cyp4f40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Cyp4f40 APN 17 32667974 missense probably benign 0.00
IGL01563:Cyp4f40 APN 17 32673956 missense probably damaging 0.99
IGL01801:Cyp4f40 APN 17 32676305 missense probably damaging 1.00
IGL01960:Cyp4f40 APN 17 32659561 missense probably benign 0.25
IGL02387:Cyp4f40 APN 17 32668010 missense probably damaging 1.00
IGL02631:Cyp4f40 APN 17 32675635 splice site probably benign
IGL02967:Cyp4f40 APN 17 32674248 missense probably damaging 1.00
R0030:Cyp4f40 UTSW 17 32675973 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676308 missense probably damaging 1.00
R0103:Cyp4f40 UTSW 17 32676309 nonsense probably null
R0180:Cyp4f40 UTSW 17 32659667 missense probably benign 0.00
R1413:Cyp4f40 UTSW 17 32673939 missense probably benign 0.35
R2882:Cyp4f40 UTSW 17 32668073 missense probably benign 0.05
R3903:Cyp4f40 UTSW 17 32659624 missense possibly damaging 0.51
R4378:Cyp4f40 UTSW 17 32668029 missense probably null 0.44
R4465:Cyp4f40 UTSW 17 32671212 missense probably benign 0.00
R4808:Cyp4f40 UTSW 17 32674275 missense probably benign 0.23
R5395:Cyp4f40 UTSW 17 32669853 missense probably benign 0.01
R5523:Cyp4f40 UTSW 17 32669822 missense probably damaging 0.98
R5889:Cyp4f40 UTSW 17 32675757 missense probably benign 0.15
R6624:Cyp4f40 UTSW 17 32671180 missense possibly damaging 0.82
R6692:Cyp4f40 UTSW 17 32675742 missense possibly damaging 0.48
R6859:Cyp4f40 UTSW 17 32675949 missense probably benign 0.19
Z1088:Cyp4f40 UTSW 17 32674002 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTACGCTGTGAGGAAAGATTAAGTG -3'
(R):5'- ATCTGATATCCTGGGGCCAC -3'

Sequencing Primer
(F):5'- CAACACAGAGGCTGGCAGC -3'
(R):5'- GGAGACCAAGAACGCAGACAC -3'
Posted On2016-08-04