Incidental Mutation 'R5377:Mgea5'
ID425656
Institutional Source Beutler Lab
Gene Symbol Mgea5
Ensembl Gene ENSMUSG00000025220
Gene Namemeningioma expressed antigen 5 (hyaluronidase)
Synonyms2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik
MMRRC Submission 042845-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5377 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45750261-45783520 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 45758022 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 779 (Y779*)
Ref Sequence ENSEMBL: ENSMUSP00000026243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243]
Predicted Effect probably null
Transcript: ENSMUST00000026243
AA Change: Y779*
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: Y779*

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,645,253 V372F probably benign Het
Adcy10 G A 1: 165,519,895 C393Y probably damaging Het
Adgrg7 A C 16: 56,730,306 I681S possibly damaging Het
Akap8l T C 17: 32,321,511 probably benign Het
Akr1a1 A T 4: 116,639,895 V156E probably damaging Het
Alk T G 17: 71,895,739 D1167A probably damaging Het
Ankrd11 T C 8: 122,893,714 probably null Het
Aspm T A 1: 139,457,483 N288K probably damaging Het
Aspm A G 1: 139,470,395 probably null Het
Asxl2 G A 12: 3,474,618 probably null Het
Atp6v0a1 A G 11: 101,055,587 H802R probably damaging Het
B4galnt1 A G 10: 127,171,822 T531A possibly damaging Het
Ccdc114 C T 7: 45,942,082 R257* probably null Het
Cecr2 A G 6: 120,756,569 N506D possibly damaging Het
Crebrf T C 17: 26,759,865 V509A probably damaging Het
Cyp4f40 A T 17: 32,675,616 I413F probably null Het
Defb12 C A 8: 19,114,326 probably null Het
Dnah2 T C 11: 69,421,848 E4297G probably damaging Het
Dpysl5 A T 5: 30,791,513 N371Y probably damaging Het
Eef1d G T 15: 75,903,189 T207N probably benign Het
Esrrb C T 12: 86,519,009 Q416* probably null Het
Exd2 T C 12: 80,489,448 L284P probably damaging Het
Fat3 T A 9: 16,376,443 I595F probably benign Het
Gm9920 A G 15: 55,108,975 probably benign Het
Hephl1 T C 9: 15,069,788 K783E probably damaging Het
Irs2 A G 8: 11,005,277 S1052P probably benign Het
Kctd18 T C 1: 57,963,093 I192V probably benign Het
Lama3 A G 18: 12,453,746 D722G probably damaging Het
Lepr T C 4: 101,815,019 V1080A possibly damaging Het
Lpin1 C T 12: 16,563,655 G504S probably damaging Het
Lrit2 A C 14: 37,069,183 Q273P possibly damaging Het
Mlkl T A 8: 111,327,937 E189D probably benign Het
Mttp C T 3: 138,105,029 R608H probably benign Het
Nav2 T C 7: 49,589,160 V2011A probably benign Het
Nos2 A T 11: 78,957,491 I1075F probably benign Het
Npat A G 9: 53,550,036 probably null Het
Nucks1 T C 1: 131,919,033 F16L probably damaging Het
Nus1 T C 10: 52,429,213 S150P possibly damaging Het
Olfr1230 G T 2: 89,297,162 T36K probably damaging Het
Olfr881 A T 9: 37,992,612 Y40F probably benign Het
Pclo A G 5: 14,681,353 T3290A unknown Het
Pign A T 1: 105,657,812 F4Y probably benign Het
Rfx4 A G 10: 84,860,542 N233D possibly damaging Het
Rpgrip1 A T 14: 52,160,195 M1325L possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf11 T A 15: 96,417,120 H1227L possibly damaging Het
Sec31b G T 19: 44,518,637 P840T probably damaging Het
Slc16a9 T A 10: 70,283,128 L426I probably damaging Het
Slc17a2 T C 13: 23,812,592 S27P probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tacc1 A G 8: 25,182,283 S310P possibly damaging Het
Tmem245 G A 4: 56,947,084 R110C probably damaging Het
Trip12 T C 1: 84,757,431 Y953C probably damaging Het
Trpm7 C A 2: 126,842,855 probably null Het
Ush2a G A 1: 188,912,123 V4561I probably benign Het
Vmn1r192 C T 13: 22,187,631 V140I probably benign Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 T C 17: 19,379,269 V405A probably damaging Het
Wdhd1 A C 14: 47,272,221 V172G probably benign Het
Zfhx3 C T 8: 108,951,185 R2956C possibly damaging Het
Zfp446 T C 7: 12,982,251 L283P possibly damaging Het
Zfp82 T C 7: 30,057,166 K164E probably damaging Het
Other mutations in Mgea5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Mgea5 APN 19 45765540 missense possibly damaging 0.89
IGL01845:Mgea5 APN 19 45767862 missense probably benign 0.00
IGL02039:Mgea5 APN 19 45773703 missense probably damaging 0.98
IGL02428:Mgea5 APN 19 45765501 missense probably damaging 1.00
IGL02581:Mgea5 APN 19 45752191 missense possibly damaging 0.53
IGL02971:Mgea5 APN 19 45762243 missense probably damaging 1.00
R0127:Mgea5 UTSW 19 45771888 missense probably damaging 1.00
R0815:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R0863:Mgea5 UTSW 19 45782986 missense probably benign 0.00
R1127:Mgea5 UTSW 19 45752155 nonsense probably null
R1501:Mgea5 UTSW 19 45778640 missense probably null 1.00
R1514:Mgea5 UTSW 19 45776931 missense probably damaging 1.00
R1586:Mgea5 UTSW 19 45776910 missense possibly damaging 0.94
R1716:Mgea5 UTSW 19 45752174 missense probably benign 0.35
R1755:Mgea5 UTSW 19 45758406 missense possibly damaging 0.93
R1774:Mgea5 UTSW 19 45776984 missense probably benign 0.37
R2152:Mgea5 UTSW 19 45758022 nonsense probably null
R4403:Mgea5 UTSW 19 45778639 missense probably damaging 1.00
R4664:Mgea5 UTSW 19 45771945 missense probably benign 0.15
R4971:Mgea5 UTSW 19 45770046 splice site probably null
R5571:Mgea5 UTSW 19 45777006 missense probably benign
R5639:Mgea5 UTSW 19 45776999 missense probably damaging 1.00
R5665:Mgea5 UTSW 19 45776997 missense probably benign 0.00
R5776:Mgea5 UTSW 19 45771924 missense probably damaging 1.00
R6050:Mgea5 UTSW 19 45765480 missense possibly damaging 0.95
R6054:Mgea5 UTSW 19 45776132 missense probably damaging 1.00
R6317:Mgea5 UTSW 19 45771680 critical splice donor site probably null
R6410:Mgea5 UTSW 19 45776045 splice site probably null
R6990:Mgea5 UTSW 19 45767476 missense probably benign 0.00
R7103:Mgea5 UTSW 19 45783166 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGGAATGTACCATCACACTTGG -3'
(R):5'- GTCTGAAAACGGATGTTAGGTC -3'

Sequencing Primer
(F):5'- CTTCTCTTGCATGAAGGG -3'
(R):5'- TCATTTCCTGATATTCCAAAGGTTG -3'
Posted On2016-08-04