Incidental Mutation 'R5378:Olfr1095'
ID425673
Institutional Source Beutler Lab
Gene Symbol Olfr1095
Ensembl Gene ENSMUSG00000075171
Gene Nameolfactory receptor 1095
SynonymsGA_x6K02T2Q125-48336843-48335917, MOR179-1
MMRRC Submission 042953-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5378 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86850770-86851696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86851463 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 78 (N78K)
Ref Sequence ENSEMBL: ENSMUSP00000097459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099874]
Predicted Effect probably benign
Transcript: ENSMUST00000099874
AA Change: N78K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097459
Gene: ENSMUSG00000075171
AA Change: N78K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-47 PFAM
Pfam:7tm_1 39 288 9.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,578,277 F39L probably benign Het
Abca2 T G 2: 25,446,068 L2150R probably damaging Het
Apob T A 12: 8,011,865 V3449D probably damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Bora A G 14: 99,068,493 N433D probably damaging Het
Cand2 G A 6: 115,801,951 A1159T probably benign Het
Ccser1 C T 6: 61,311,666 A271V probably benign Het
Ccser2 G A 14: 36,879,434 T331I possibly damaging Het
Cemip A G 7: 83,958,525 S758P probably damaging Het
Cenpf C T 1: 189,653,466 V2206I possibly damaging Het
Chrnb1 A T 11: 69,785,181 S412T probably benign Het
Cks1b A C 3: 89,416,301 W54G probably damaging Het
Col5a3 C T 9: 20,797,576 V630M unknown Het
Dnajb14 A G 3: 137,885,378 D30G probably benign Het
Dpp8 T C 9: 65,078,014 Y785H probably damaging Het
Dsel T A 1: 111,862,821 probably benign Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Esp8 G A 17: 40,530,142 C98Y unknown Het
F11 C A 8: 45,252,143 M120I probably benign Het
Fsip2 T C 2: 82,989,841 F5306S possibly damaging Het
Gm4841 T C 18: 60,271,041 probably null Het
Gpr180 T A 14: 118,139,839 L84Q probably benign Het
Grwd1 A T 7: 45,830,081 D123E probably benign Het
Hsfy2 T C 1: 56,636,668 R237G probably benign Het
Htr5a A G 5: 27,850,995 Y328C probably damaging Het
Klrb1f G A 6: 129,053,831 A127T probably damaging Het
Mcpt4 A T 14: 56,062,293 probably null Het
Muc5b T C 7: 141,862,203 V2962A unknown Het
Olfr601 T A 7: 103,358,445 I250F probably damaging Het
Otog A T 7: 46,255,004 T518S probably damaging Het
Phgdh A T 3: 98,321,323 probably null Het
Pip5kl1 A T 2: 32,579,094 T213S probably benign Het
Plekhg2 G A 7: 28,362,669 R594W probably damaging Het
Prg4 T A 1: 150,455,226 probably benign Het
Prpf40a T A 2: 53,145,876 D621V probably damaging Het
Ptprz1 A T 6: 23,007,402 I1655F probably damaging Het
Rbm28 T C 6: 29,128,559 K55E probably damaging Het
Rbm43 A T 2: 51,925,621 V196E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,380 M434L possibly damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35f1 A T 10: 52,691,061 H22L possibly damaging Het
Smg6 A G 11: 75,041,994 D98G possibly damaging Het
Strbp A G 2: 37,599,174 Y527H probably damaging Het
Strbp A G 2: 37,600,806 V479A probably benign Het
Tcrg-C2 T C 13: 19,305,127 Y145C unknown Het
Tdg G T 10: 82,641,471 V119L probably benign Het
Trav10d G A 14: 52,811,368 R72H probably benign Het
Trim25 T C 11: 89,009,267 L280P probably damaging Het
Tsc22d4 A G 5: 137,762,464 D49G probably damaging Het
Ttn T C 2: 76,890,190 probably benign Het
Tyr T A 7: 87,472,495 H363L probably damaging Het
Ubr5 A G 15: 37,989,578 S2020P probably damaging Het
Usp9y T C Y: 1,315,928 D2069G probably damaging Het
Vmn1r170 T C 7: 23,606,538 W122R probably benign Het
Wdr7 G A 18: 63,825,239 probably null Het
Ylpm1 T A 12: 85,030,255 H793Q probably damaging Het
Zadh2 G A 18: 84,094,678 A160T probably damaging Het
Zfp266 G A 9: 20,499,363 T506I probably damaging Het
Zfp518a T C 19: 40,915,856 S1410P probably damaging Het
Other mutations in Olfr1095
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Olfr1095 APN 2 86851197 missense possibly damaging 0.77
IGL02947:Olfr1095 APN 2 86850786 missense probably benign 0.00
IGL03106:Olfr1095 APN 2 86851614 missense possibly damaging 0.92
R0631:Olfr1095 UTSW 2 86850967 missense probably benign 0.07
R1640:Olfr1095 UTSW 2 86851227 missense probably benign 0.05
R1718:Olfr1095 UTSW 2 86851187 missense probably benign 0.22
R1936:Olfr1095 UTSW 2 86851401 missense probably benign 0.01
R3720:Olfr1095 UTSW 2 86851591 missense probably benign 0.16
R4177:Olfr1095 UTSW 2 86851401 missense possibly damaging 0.56
R5589:Olfr1095 UTSW 2 86850774 missense unknown
R6158:Olfr1095 UTSW 2 86851515 missense possibly damaging 0.92
R6326:Olfr1095 UTSW 2 86850994 missense probably benign 0.00
R6637:Olfr1095 UTSW 2 86851440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCACCAGCATAGGAAGCAATG -3'
(R):5'- TGTTCTCAAGGGACTCACAGAC -3'

Sequencing Primer
(F):5'- TAGACTCGAGGAGACATGCTCAC -3'
(R):5'- AGACAACAATGAACTTCAGATCATTC -3'
Posted On2016-08-04